GenePrediction:GLEAN_2000 Details

Name: GLEAN_2000
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:50376..51217 (+ strand)
Length: 842
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:50376..50414 (+ strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_108:50563..50669 (+ strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_108:50743..51217 (+ strand)
Length: 475
>GLEAN_2000 class=GenePrediction position=GCSC_108:50376..51217 (+ strand)
ATGGTTGGCGTCGCACGGCGCATGAACAAGCTGAAGGCTGTGAGTTGCTTCGCATCCCCATCAGCAAGCTTTCGATCGAT
GCTAACTCCCCTCTCTCTCTCTCTCGCTATAGCAGGTAGATATCCTTCTGCTGCGGTCTCTGACGCCTGCTTTTTCTGGG
AAAACGTGAAACTGACTCGCCCCAAAGCTTCTCAACATACGACACGGTCCCGGGGCTGCGCTTCTGCCTTCTGAGGTCTC
AAGGATACACCTGGAATTCGCCCAGCGGTGGAACGACGGACAGTATGGCCCCAGGTAAGAGAGATGGCCCAGAGCCTGGA
CCGACCGCTTCGAGCGGTACCGTCACCCGAAGCTGACAAGCATGCAGAAAATTCTGGCAGACCTGTTTGCCGCGCCTGAA
ATACTGGAACCCGGCCGTTCCTATGATCGTCAACCGCACATCCGAGGCCACCGGTCCGGCCACTCTGACCATCTACTTTC
GCCAGAAACAGGAAGGCGTCATAGCAGCCGCAGAAGCCACTGAAGCAGAACCACAGCCTAGCTCGTCTTTTGTCGGCGAG
TCCAAGGCTCCGCAGCCCACCCCCACCGAGCGCACCGTCCAGATCGACATGAAGGGCCTGCGCTCAGACGCCATCCTCCA
GGATTTCCTCAGCAAGTCTGGTGCCATCCCAGTCTCCCCATCGTCCCAGGAGCAGGCCGACATGCGCGAAGTCGAGGAGC
GTGCCGAGCGCGCCAGCGTCGACCGTGAGGTTATGCTCAAGTACCTGACAGCTCGGCGACGTGAGGCAGCTCTGCTGGCC
CAGGCAAAGAGCGAGGTAGATTCTTTGAAGCAGAGTGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62