GenePrediction:GLEAN_2001 Details

Name: GLEAN_2001
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:57165..58247 (+ strand)
Length: 1083
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:57165..57194 (+ strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_108:57259..57382 (+ strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_108:57463..57769 (+ strand)
Length: 307
Type: CDS
Source: GLEAN
Position: GCSC_108:57833..58247 (+ strand)
Length: 415
>GLEAN_2001 class=GenePrediction position=GCSC_108:57165..58247 (+ strand)
ATGGCTGATCCGCGTGCCTTGCTCCAAAAGGTTCCATCCCTGATGCTCTCCACAGGTCTTGATTGGTTTCATTTCTAACG
TTCGGACAACGTAGGCGGAGAAGACGGCGGCCAGTGCTGGCAGTGGTTTTGGCTTTTTCGGCGGACGCGAACAGAAGTAC
TTCGACGCAGCCGATCTTTACACACAGGCGGCCAATGCGTTTCGGTTGCAGAAGAGTAGTAAGCATCAGGACCATGCGCG
AGAGAGGCTGGGCATTATCTGGATTTCGACATTGCTGACCGGCTGCCTCGTCGCACAGATAAGGAAGCGGGCAAGGCGTT
TGAACTGGCTGCTGCCATCCAGAAGAACAACTTGAAGGAGCCCGATGACGCTGCCAACACGATGAACGAGGCGTTCAAGG
TGTACCGCAAGGAGAGCCCGGAAGATGCGGCACGGTGCCTGGACGAGGCTATTCAGCACTACTGCGCCCGTGGTAACTTC
CGGCGAGCAGCAAAGCAGAAGGAGGATTTGGGCGAGATTTACGAGCTGGAGCTGGGGGACCCCAAGAGAGCTCTGGAGAG
CTACGAAAACGCGGCATCCTGGTACGAGGGTGACAATGCCCAATCGTGCGTCTCCCATTTCCCACTCCTCTGTCCCGTCT
TGGTTGTTGGAAGCTAATTGTCTTGCAGACTGGCCAACAAAAACTGGCTCAAGGTTGCCGACCTCGCCGCCCTAGAGGGT
GATTACTACAAAGCGATCGAGCAATTTGAAAAGGTGGCACAACAGTCCATTTCCAGCAACCTTATGCGCTATTCGGTTAA
GGACTATTTCCTTAAGGCTGGTCTCTGCCATCTGGCGACCGGGGACTTGATCAGCGCACAGCGTGCCCTCGAAAAAGTCC
GCGAGCAGGACCCGAGCTTCGCCATGCAGAGAGAGAACCAACTGCTGGTTGACCTCGTGGAGGCTATCGAGGCGGGTGAC
GCCGACAAGTTTGCTGAGAAGTTGTTTCAGTACGACCACATCAGCAAGCTGGACCGGTGGAAGACCACGATTCTCCTGCA
GATTAAGTCCAAGATCGAGGAGGCCGATAACGAGTTTGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62