GenePrediction:GLEAN_2003 Details

Name: GLEAN_2003
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:62979..63534 (+ strand)
Length: 556
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:62979..63041 (+ strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_108:63103..63118 (+ strand)
Length: 16
Type: CDS
Source: GLEAN
Position: GCSC_108:63229..63291 (+ strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_108:63356..63534 (+ strand)
Length: 179
>GLEAN_2003 class=GenePrediction position=GCSC_108:62979..63534 (+ strand)
ATGTATGCCACTCGGGCTCTTCGCATGTTCCGGCCGACGCTCCGCATGATGCGGCCCGTTCCCGTAAGTCTCGGTGATGC
TGCCAGATGTCCATGCACACGATTGCTAACAGTCTGGCTGGCAGAAGGAGGAGCAAGCCGGTGCGTGTGGCGTGCTGTTC
CATTGACCCCAGACAGCACCGAGACGACTGCCAGTTGCGAGATGCAATTGATTGGAATCGAAAAACTAATCAAGCTTCCC
CCGAGATCAGCCCACACCGTCTCTCAGAGGCTGCGCCGCCTGAAGAACATCCCGGCCGAGCTGCTGCCCCTCGGTGCGTA
TCGGTGTCGCAAGTCTCCAGCCTTCTCATCGTCTTTCCGCTAACACCCGCGTCGCAGGTGTCGTCGTCGGCTTTGCTGTG
TTCGCCGCCGGCTACTCCATCACCCGCCACCTATTCGTCGACAAGACCATCCGCCTGAAGCGCCAGAACCGTCTGGCCGA
TAACGCTGCCCACGGCCACGAGGAGCACGCCGAGGCTGCCGAGCACGCCGAGGCCGTCGTGGAGGCGAAGCAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62