GenePrediction:GLEAN_2004 Details

Name: GLEAN_2004
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:64938..68981 (+ strand)
Length: 4044
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:64938..65143 (+ strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_108:65208..68886 (+ strand)
Length: 3679
Type: CDS
Source: GLEAN
Position: GCSC_108:68937..68981 (+ strand)
Length: 45
>GLEAN_2004 class=GenePrediction position=GCSC_108:64938..68981 (+ strand)
ATGGTGCAACTCCGGGAGATCCCGCGCACGGCGGTCTTCGCCTGGTCGCCGGGCACGGACAAGCCGTTTCTTGTGACGGG
AACGCGTGCTGGCGCAGTCGATGCCGACTTCTCTGACGAGACCAAGCTAGAGCTTTGGGACCTGAGCCTTGACAGCAAAG
ACGGCGTCGAGCTGCAGCCGGTCCACAGCATAAGCACAGACTCCAGGTGTGTAGCCCCCCTTGTTCTGGGTGCTTGTTTG
CCAATGGCTGGCTAACGCAGCTGGCGGTAGATTCTACGATATTGCCTGGGGCCCACCGGACGAGGACTACCCGCGTGGTG
TCATCGCCGGAGCTCTGGAGAGCGGAGCTCTGGAGCTCTATGATGCGGAGAAGCTCGCACTAGGCGCATCTGATGCGCTC
ATCGACAGTACGACGAGGCATAGCGGGGCCATCAAAACGCTGCAGTTCAATCCGATGCGGCCGCAGATTCTGGCGACGGG
TGGCGCCAAGGGGGAGCTGTTCATCTACAACATTGGAGACCTCCAGAACCCATTCCGGTTGGGCAACGCGGCAGCGTCGC
GTGCGGACGACATCGAGGCGCTCGCATGGAACAAGAAGGTGTCGCATATCCTGGCAACGGGAGGCAGTGGCGGTCAGGTG
ACGGTGTGGGACGTGAAGACCAAGAAGGCGTCTCTGACTCTTAACAACAACCGGAAGGCTGTCAGCGCGATCGCATGGGA
CCCGACCAACTCGACCAAGCTCATCACTGCGAGTCCGGATGACAACGCTCCGGTGATCTACCTGTGGAATCTGCGCAACT
CGAATGCTCCGGAGAAGACGCTCAGCGGCCACGAGGCGGGCGTATTGTCGCTGTCGTGGTGCCAGCAAGACCCCGACATT
CTGCTGTCGTGCGGCAAGGACAACCGGACGCTTGTGTGGAACCCGCAGACGGGCGAGTCGTATGGCGAGCTGCAGCAGGG
CACGAACTGGGCGTTCCTGACGCGGTTCAACCCGGAGAACCCGAACCTGACGGCGACGGCGTCGTTTGACGGCAAGATTA
CGGTGCAGACGCTGCAGAACACGAACAACACGGCCGATGCGCAGGCTGCGGCACAGAGCAACCTGGACGGTGAGGACTTC
TTTGCGTCGGCGCATACTGCACCGCAGGTGGCATCGTTCTCGCTGCCGAAGCCGCCAGCATGGTATCTGAAGCCGGTGGG
CGCGACATTTGGGTTCGGCGGCAAGGTGGTGTACTTTACTCTGAACGACACGCCTGCTGGACAGCCTGCGTCGTCTACGG
TTCACATTGGGCACTTCTCGGCCGACGCCAAGGTTGCTCCGACGACGGAAAAGTTTGAAGAGGCACTGCAGTCGGGTGAC
GTCAAGGCGATATGTGCGTCGCACATCGAGACGGCCAAGACGGATGAGGAGAAGGCAGACTGGGAGGTGCTAGGGACGCT
TGTGGATGCGAACCCGCGCCAGAGGGTGATTGAGCGGCTGGGATTTGACAAGGACGAGGCGACGGAGGAGGATACGAACG
GCGTGGTGACGGAGGAGAAGAAGGCGCAGGAGGAAGAGAAGGAAGAAGACAGTTTGGCGTCGACAGACGGAAAGAAGACG
GACAAGGATCAGCTGTCTAGCTTTTTTGACGACAAGGGCGATACGGGCGGCGACGAGGACGACTTCCTCGCAGGTCTGTC
GGCGGCAAAGGACGAAAAGGACGCAAAGGACGAGAAGAAGACGAAGACGAACGGTCCATTTCACCTGCTGGGAAGCGGCA
ACACGGCGCTCGAGGACACGATCACGAAGGCGGTGATGCTGGGCAAGTTTGGGCGGGCGGTGGACATCTGCCTCAAGGAG
AACCGGATCGCGGACGCGTTTGTGATTGCCAACTGCGGCGGCAAGGAGCTGGTGCAGAAGGTGCAAGCAGCATATCTGGC
GGAAACGCAGGGGACGCCGAGCTACCTGCGGCTGCTGAACTCGGTGATTGCGGAGGACCTTCGGGACGTGGTGCAACAGG
CGGATCTGGCTAACTGGAAGGAGGCGCTGGTGACGCTGTGCACGTTTGCGAAGCCGGAGGAATTCCCCAAGTTCTGCGAG
GGACTCGGCGACCGGATTCTGGAGGCGGGATCGCGCAAGGACGCGTCGTTCTGCTACCTGGTGGGCTCGCGGCTGGAGAA
GGTGGTGCAGATCTGGATCAGCGAGCTGGACGAGGCGGAGAAGGCGGGAGTGCAGGCAGACGCGACAGACTCGTCGTACT
CGGTGCATGCGAAGTCGCTGCAGCAGTTCATTGAGAAGGTGACCGTGTTCCGTCACGTGACCAAGTTTGAGGACGGCGAG
GCGAGCCTGACGTCGGGCTGGAAGCTGGCGGCGCTGTACGACAAGTACATTGAGTTTGCAGACATTGTGGCAGCGACAGG
ACTGATGTCGGTTGCGCAAAAGTACCTGAACCTGGTGCCGACGACATACGAAGCGGCCGAGGTGGCGCGAAACCGGGTGC
AGCTGGCATTGCAGAAGACGACGGCGGTGCCGCAGCATCGGGCAGCGACAGCAGCTGGACAATCGCGGGTGCCCAAGTCG
CGTACGCCAGCACAGCCGCAGGCGGTTTTAAACAGCGGGAGTCCTGTGATGGCTGCGATGCCACGACCTGCTGCGATGTC
TGTGAGCTCGGCAACGAACCCATATGCGCCTCCTCACGTGACCTCGGCAGCTCCAGTCAATCCCTATGCACCTCACGTGA
CGCCAGCAGCTCCGGCCAACCCATATGCGCCGCCCGGTGTCGGAGGACGGACGAGCAACAGCCCGTATGCACCGCCTTAC
GGACAACCACAGCAGACGTCAGCTTATGCGCCGCCGACGGGGCCGTACGGAGCACCGGTAACGACGCCGGCCTACGGAGC
ACCGCCGCGCAACTCGACGACATCGGCACCGCCTCCATCGCGAACGGTGGATGCCGGCAGCTGGAACGACGTGCCCATGG
TGACGCGGCCGCCAGTGCGGAGAGCGACCCCCAACATGGCGCCCATCACAGCGCCGTTCGGAGCCCAGCAGACAGCAGTG
GGACCTCCTCCGGCCGGCCTCTACAGTCCATCTGGTCCTCGCGGAACAGCGACGCCGCCTCCTCCGCCCAAGGGCTCGGC
ACCGCCACGTGTGACATCCCCGCTCGCAGGACCGCCTCACAACTCTGCAGCGGCCGTGCTGTCGCCACCACCGCGTCCGA
CTTCGTCGGCCGCAAACACATATGCACCGCCACCACCTGCAGTAGGGAGCAACACGCCTGCAGCCATGGTGCGGCCACCC
CCTCGGACGGAGTCGCCCTACAACCAGCCGCCGCCTGGACCGGCACCCACGAACCGGTATGCTCCCGTGGCGGCTGTGCA
GCAGGCGTCCAGCGCCGGGCCACCGATCGGGTTTGCACCGCCGCCTTCAGCAGCAGCCACGCATGGCCGATACGCACCGG
CGCCCTCGCCCTATGAGATGACACCCGGCCATATTGGCCAGCCGCTGCACCAGCAGCACCAGCAGCACCAGCAGCAGCAG
AGCATGCCGCCAATGGTGCCGGCTGGACCACCGCGTGCTAGTCCGGCTGGGTCGGCCATGGCGACATCGCCGCCGCCGTC
GCAAGCACCTTCGCAGCCGACACCACCGCCGGTCCGCAAGACGAGATACCCGGCAGGCGACCGGTCGCACATCCCGCCGC
ACGCGCAGCGTCTGGTGCAGATCCTGGACGCGGACCTACAACGTGTGGCGGCCAAGGCGCCGCCGGCATTTGCGGCACAG
GTCAAGGACACGAACAAGCGGCTGAACCTGCTGTTTGACCATCTCAACAATGCGGAGCTGATCAAGGAAGACACGGTGCA
CCAGCTGCACCAGCTGGCCGAATCGCTGGAGGACAAGGCCTTTGACGCGGCACAGCGGGTGCAGGTGGAGATTCATCGTG
CGAAGCCGGAAGAGTGCGGCAACTGGATGGTAAGTCTGCGTTTCTTTCTCTTTGTTGTCGTGCCCTGCTAACTTTTCAGG
TCGGTGTCAAGCGCTTGATTGCCATGAGCAAGGCCACGCCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62