GenePrediction:GLEAN_2005 Details

Name: GLEAN_2005
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:69254..70298 (+ strand)
Length: 1045
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:69254..69422 (+ strand)
Length: 169
Type: CDS
Source: GLEAN
Position: GCSC_108:69481..70298 (+ strand)
Length: 818
>GLEAN_2005 class=GenePrediction position=GCSC_108:69254..70298 (+ strand)
ATGACTGAGAGCGCGGCACCAGAATCGGCGGCACCAGACCAAGATGCGGCAGCGGCAGCACGGCTTGCAGAGGCCCGCAA
GCGCAAGGAGCGGCGAGAGGCCAAGATCAAGGCGGGCGGCTCGTCGAGGCTGAACACGATCTCCAGCCTGGGCGGAGGCC
TGCAGCGGGGTGAGCAGTTGCAGCAACAGCGGTGGCATTGTTCTGATGTGCTTGCTAACATCGGCAGAGGAGCCTCGGGC
TGTTCCCAAAGCGGAGGCAAAGACGCCCGGCGACCCTGACGAGATTGACATTTCGGAGCACTTTTACGAGCCGACGACGA
CAGCGCGGCCGCAGGCGACAGCAGGCGGAGCAGGCGTATCAGAGGCCGACGCGCAGCTTCTCGAGCTGCTGGGCCAGTCG
CAGAGCGCGGGCAAGGATGGGCTGCCGGAGAACGACCCGATGGCGGCGATGCTGGCTCAGATGATGCAGAGCATGGGCGG
ACCGGGAGGACCGGGAGGGCCGGGGCTGGGCGGCGGCGGCTGGCCTCCGACGATGCCTCCGATGGGACAGCAGCCGAAGG
CAGCGGTGCCGAGCGCGTCGGCGGCGCTGTGGCGGCTAGTGCACTTTGCGGTGGCGGTGGCGCTGGGCCTGTACGTGGCC
TTGTCGACGCCGTTTGCGGGCACGCGGATCGAGCGCGAGCAGTCACAAGCAGCGCAGGAAGCCGTGGGCAGTCTGGACGG
CCTGCACGGCATGGACGGTGCAGCCGGGCTGGACGACTACGACAGCGTGCAGCGGCGGTACTTTTTCTACGGGTTTGCCA
CGGCCGAGACGGTGCTGCTGACGAGCCGCTTCTTCCTCGAGCGGCAGGGCGGCGGTGGGCTGTGGGGCAGCAGCAGCGGC
AGCGGTGGTGGCGGGCTGCTGAGCATGGCCCTGGGCTTTGCGCCACCAGCGGTCCGGCGGTCCGTCGACGTCGGGCTGCG
GTACTGGCAGATCTTCAGCACGGTGCGGTCGGACCTGCTGGTGTGCGTGTTCGTGCTAGGCGTCTGTTCGTGGGTGCGAG
GATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62