GenePrediction:GLEAN_2008 Details

Name: GLEAN_2008
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:78565..85159 (+ strand)
Length: 6595
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:78565..78769 (+ strand)
Length: 205
Type: CDS
Source: GLEAN
Position: GCSC_108:78874..80480 (+ strand)
Length: 1607
Type: CDS
Source: GLEAN
Position: GCSC_108:81092..81380 (+ strand)
Length: 289
Type: CDS
Source: GLEAN
Position: GCSC_108:81461..82378 (+ strand)
Length: 918
Type: CDS
Source: GLEAN
Position: GCSC_108:82435..84982 (+ strand)
Length: 2548
Type: CDS
Source: GLEAN
Position: GCSC_108:85045..85159 (+ strand)
Length: 115
>GLEAN_2008 class=GenePrediction position=GCSC_108:78565..85159 (+ strand)
ATGGCGGTTCACTACTGCAGACAGAAGAACTTCCAAAGCCAATATCACATCTCCTTCTTGCTTCCCCTCTTCTCCAGGCA
CACGACGCAGGCGATGGATCTGGCAGAACGTGTCAAGGCTGTCATCGAGGCTGACGTCCTGTCGTCTTGGCATGGCCTCT
CCACTGCGGCCTCGGCGCCGAGACGACCGAGTCATCCTGCACTTTGTGAGCTTTTCCTGCTTCTTTGCCGTTGCATTTCT
CCCTTTCCCTGGCCTGGCTGACTCTCTTCTCCCCCCCCAAGGACTATGACTGCTTTTATGCCCAGGTAGTGCAGAACCGG
GCTCCCGGTGGCCTTCTGGCCGGCCGTTGCGTTGGCGTCACCCAGAAGAGCATCCTGGCCACGTGCAACTATGCGGCTCG
GCGTCGTGGCGTCCGCAAGCTGATGCGCATCAGCGAGGCTCGCCGCGTGTGTCCTGACATTGTGCTTGTCGACGGCGAGG
ACCTGTCGCCGTTCCGGGATGCGTCTAAGCAGCTGTTCCGCCTCGTGCGGCACCTTGTCGGTACTTTCGACGGCGCTTCA
GCCAGCAGCTGTCCTGTCGAGCGGCTTGGCCTAGACGAGGTCTTTGTCGATGTCACCAGCCTCATCGACGCCAACATCGA
TCGTCTGCACGCCCTGCCCGAACTACACGATCGTACACGGGCCTTCTTTCAGCTTCCAGGCGAGCCGGACTCGCCCGACG
ACTTTGGCTTCGCCTTTGATGCCACCTCGTTTTCCGGTCATGTCGTCGGACAAGTTCCCGTCTGCTGGCCCTCGTCCTTC
CATCGGCTCCTCCTCGGCTCTCACCTCGCCGCTTACCTGCGTGGTCGCCTAGAGGCCGACGCTGGCTACACCGCGTCTGC
CGGCATCGCCACCAACAAGCTGCTGGCCAAGCTGGCCGGCAAGCAGCACAAGCCGGCCGCCCAGACAACTTTGTTGAGTG
ACGACACCGTCGTGCTCGCCTTCATGGACGTCTTGCCGCTAAGCAGCGTCACCGGCATCGGCTTCAAGACGAGCCGCCTC
GTGGCCGAATTCGTTCGACGGGAGTCCGAGCAACTAGACCAGCCGGAACAGCCAGAAGAACTGGACGGCTTCGATCCTGA
TGGACGGCCGTCTGTCAATGTGACCGTCGGTGAAGTCCGTCTTTATCCCCATATGTCGGCACGTCTGTTAGAACATGTCT
TAGGAGGCGAATCTGGGTCGTCTTCTCTCCCTCCTGCCTCGCGCGTTTGGGCTCTTTTGCACGGCGTTGACGACACCCCT
GTGCGCCCGGCCGCCGATGTGCCCTCACAGATCAGCATCGAGGACACGTATGCGGGCCCGCGCCGACATCTGCTGCAGCC
TGGCGTTGGTGCAGCCATGCCACCGCCTTCCGTCGTCGACGAGCTGCGCAAGCTGGCCACGTCGCTGCTGCGCCGGATGC
ACGTCGACCTCTTGGGCCAGGAGCCCGTTGGTGGAGGTCCAGCCTCCAAAAAAACATGGCTCGTTCGGCCGCGGACGCTT
CGGCTAACTCTGCGTCCTCAACCCGTCGATCCCGATGCTGCAGCCACTACCACCACCACCTCACCCTATGCCTACTCTCG
TTCCAGTTGCAGCCAGCCGCTGCCCGGCTTTGTATTGAGTCTAAATACGCCATCATCCCAGATTGTCGACCGTCTGGTGA
CCGGCAGCCTCGTTCCCATGTTCCGTCGGCTGGCCGCCGCCGTGGTGCCGCCAGGTGCCAGCAGCATTACCGACAGCCGC
CTCACACGTCACTCGTCGGCCTCTTCTGCCTGGACCGTAGGCCTGTTGAACGTGTGCGTGGCCAACATGGCACCTGTGGC
CGCCGAGGGCGACAGCATCGCCGCCCTCTTCCGTCGCCAGGAACAAGAGATAGAAGGCGCTGAAAGTAGCCATGGGGTTA
GTGCCGAAAGTGACGAAGACGACGAAGACGACGAAGACAATGACAACGACAATAGCTGGCTCACTTCCGACGATAGCGGC
CCTGCTGTAGAGGCCTGTAACCAGTGTGGCCGTCTTCTTCCCTCCTTTGCCCAGGCAGCACATGCTCGATTCCACTTGCT
AGGAGATGCATAAAAGTCACTCTGCATTCTATTGACAACACAGATTGTGCTTTCCTGATTGTTTGAGAATGCGTTCTTGG
TGACTGAACTCCGTGTCGTAGACAACCAGTGGGCACATTGTCCGAGCTTAACGCCGTGTAAGTGGTGAATGGTAACCCGT
GACCACCAGCTGCTGCCGGCTGTCCTAGTGTGTCTCAGTGAGACACGCTTAATGACGTCAAGCTGCTCACAGACAAGAAC
AAGCTCCAGAAGCGGCCACATCCCTCGCAGCCCTGCATTGCAGCTCTCTGCCGTTTTCGCATCGGCGTTAGTAAGATACT
GTCCAGTCGTTCTAGGCGTTGATGACGCCAGTCCGTTGGCGTGGCTGTGACGACATCCGCTCGTCCTGCTCTGTATTTTT
GTCCCTCAAGTGTCCCGACTCCGAAGAATAACCATTGCCAGGTTTAGCTTCGTCTCGGCAATACGCAATTTCCCCCGTCT
CTTGCCGTCGCCATGTCCAACGTCAAAGACCATCTCGTGTCTTCGGGCCAGCACTACTCGGGTGCCAATCGAGTGCCCAA
CATCAAGCAGTTCGTCGAGAGCCTTGACAAGGAGAAGAGGCTGCGCGATTCCGAGCTCGAACAGCGTCTCAGAGACAAGG
CTGCCAATCAGTCTGGTGAGGCTACCGACCACAAAAATGGCAAGCCTGGCCGACTCAACAATCGTCGAGTGGTGACCGAC
CCGGTAACAGGGAAGGGTGCGTAGGGATGTTGGCTGTTGTGCTGTTTGTTGTCTTAATGGCTCCGTCGTCTTGCCGTCCG
TCCGCTGACCGTCCAGATGTCGAGATCGACGACATGGATTCGTCCATGCTCAAGGCCGCAAAAGACCCCAAGCTGTCCGT
TCCCAACGCCAATCTGGGCAAGGACACCACTGCCCAGACCAGACACACACAGTCCGGTGAGGAGTATCGCCGCAATCAGG
ACATCACCGCCCCACCCGATCCCATCGAACCAGGTTCCACCAGCGATGTCCCCATCCATGGCGAGAAGACCAACGTGCTC
TTCCACCCTACTCCGGCCGTCAGCTACGAGCCCATGTTCGCCGCCATTCAGGCCCGTGCCAACGTTCTCTGTGCCGGTCT
CTTCCTAGCCGTCCTCTTCCTTGGCCGCCTGTTCGGAGGACATCTGCTGGGTCTGGTGCCGCTGGCCGCCGGCGTCGCCT
CGGCCGTCTTCCTCTGGACCCAGGACCTTATCCGCCGTGGCCGTGACGTCGAATGGTCTAGCGAGCAGAAGCGCGGCGAG
ACCGCCGTTGTCAACCTGATTCCCGAATCTGTCGAATGGCTCAATTCAGCCGTGTCCCTGGTCTGGGGCCTGGCCAACCC
GGACATGTTCTCCACCGTGGCCGACACCCTTGAGGACGTCATGCAGGCCAGCGTACCCGCTGTCATCGAGAACGTCAAAG
TCAACGATATCTCCCAGGGCACGAATCCCATCCGTATCCTCAGCCTGCGCACCCTTCCCGACAGTCACTTGCAGGATCTG
CGCGACGAGATTCGCAAGCGCGACGAGCGGGAGAAGGACCCCAACGAGATAGCCGCCGATGAGGAGGGCGGTGACTTTTA
TAATCTCGAGGCCACTGTTGCATACCACTCGCTGCCATCGAATGCCGACGTCTCCTCCAAGGCCCGTAACATGGGCATGC
AGCTGGTCTTTTACCTCGGAATCAAGGGGCTTTTTGGCGTGCCGTTTCCCGTCTGTGAGTCTATGCTTTCGCTTCGCTGC
AGATGTTTGATCCCCTTCTGACGCACACAGGGGTTCAGCTGGACGGTCTCGTCGCCACGGTGCGCCTGCGTGCCGCTCTC
GGACCTAGTCCCCCGTTCATCAAGACGCTGAGCTTCACCCTGATGGGCCTGCCCAAGATCCAGGCCAGCTGCGTTCCCCT
AATCGAAAAGGGCGCCAACATCCTCAATTTGCCGCTCATATCCACCTTTGTCAACTGGGCCATCGCCACGGCCGCCCACA
TGTACGTCGCGCCCAAGTCCATGACCCTCGACGTCGGCAAGATGCTACAGGGCGACACGATCCAGAAAGAGACCGACGCT
TTGGGCATACTCTTCATCCGCATCAACAAGGCCGTCGGCCTCAGTAAGCAAGACACGCGCGGCAGTCGCGGCGGCGGCTC
GGACCCGTACATCTGCATCGCCTTTTCCAAGTTCGGCAAGCCGCAGTATTGCACCCGCGTCATCCAGGACAACCTAAACC
CCATCTTCTCCGAGTGTGCGGCGCTGCTGGTTAATGCAGACGTCATCCGTGCGGACGAGCAGCTCTCGCTGGAGCTCTGG
GACAGCGACCGCTCGTCGGCCGACGACGTTGTCGGCAAGGTCGAGCTCAGCATCCAGAAGCTGATCCAGCATCCGGGCCA
GATGTTCCCGCAGGTGTCGCAGCTGCGCGGAGTCAAGGCTGAGAGCACGATGCCGGGCGAGCTGCACTGGGAGGTGGGCT
TCTTTGGACGCACACAGTTCCGCCGTGCCCTGCGCACTGACGGCAAGGACCCGTTCATACCCAAGGAGCTTCAGGACAAG
GCCGAGCTGCAGGAGGACAAGGGCGTGGCCAACACGGAGGAGGAAGACGCAGTCATGTACACGCCGCCGGATCCGTTGTG
GCCGAGTGGCATCCTCAGCATCGTGGTGCACCAGATCGTCGGCCTAGAGCTCGAGAACATCCGTGGCTCGGATGGGAACC
GCAAGAACAAGGAGTACGAGCCTGCGCGGCCCGAGGCCGGCGAGCTCAAGGAAGAGCAGGGCAAGAAGCTGCCCAGCGCA
TACTGCACCATCATCATCAACGATGAGCTGGTGTACAAGACGCGGACGAAGGTGGTGTCGTCACGGCCCATATTCGAGGC
CGGCACCGAGCGGTTTGTGCGCGACTGGCGCTCGGCCATTGCCACCATCACCGTGCGCGACTCGCGCCACCGTGAGCATG
ACCCTATCATCGGTGTGGTGCCGCTGCGGTTGACCGACATTCTGCTCAAGAGCAGCCAGAGCACGCGGTGGTATCCGATA
GACGGTGGCATCGGATTTGGCCGCGTGCGCATCAGCCTATTGTTCCGCTCTGTCGAGCTGAAGCTACCGCCGGCCCAGGT
GAGCTTCGGTGAAGTTGGTACGTTTGAGTTTCTCTCAGACGCCCTTACCACGACCGGCTATGCGCCGTCGTCTAGTGTGA
AGATCCGCATGCGCACAGGTGGCAGCACGGCACGGATCAAGAGCGACAGATGCTCGCGGACTGAAGAAGGCAACGGCCTG
CGCTGGGACATTGGTGCGCGGTCCGGAAAGACGGTGGACGGTCAGGTCGAGAAGGACGGAAGCGATGGCCGGGAGATCCC
TGTTGGAAATCTGCGTCTGCCAGTGCAGTACCGATATCGTTCGCCGGTGTTCTTTGAGTTCCACGTGTCTGGCATCCGCA
GCAAGAATGCGTTCTCGTCCATCTGGCTGCAGGATCTCGTGGACAACGAGGAGAAGGAGTTTGACGTGCCGGTGTGGACG
TGTGACAACCCGTTGCGGCTCTCGCAGAGCTACATAACGGAGGAGAACTGCAAGGATGTGCCGGATCTGAAACTGGAACA
GGTGGGCCGCCTGCACTTTCGCGGACGTTTCAAACCCGGCACAGACCGGGAGCACCTGCGGTTCGTGAGTGACAACGACT
CGCGCGAGACAATTGAGAGCTGGGAGGCGTGCTATGCCGAGGGCGTGCGTGGCGAGGAGGTCCAGGCCCAGGTGCCGAAG
CTGGTGCGCCACATGCACGAGAGGTCGTTGACGCAGGGCCGTGATGTGTTGGCCCAAGCGCCAGAAGAGGACAAGCAGCG
GTGGCTTGGCAAAGACGGGACTGATTGGACGGGAGCCTTTGGCCAGGACGAAGCCGAGATGGAAGAGGTCAATGGTGCTG
GCGATGGCGTGGGTGAGGGCGAGGAAGAGAGAGACCGAGATGCTCTACAGATTCCACGCCACCACGAAGTCAGTGGTGAG
ACCCAACGTGGTCAGGCTGTCGCGGTTGAGGACGAGTATTTCGACGACAATGGAAGCAGCAGCAGTTGCAGTACCGCGAA
TAGTGGCGCCTTGGTCGACCTGGGCGTGCAGGATGGAAACATGGTCACGCCCGCCAAACGAAGGAGCAGCGGGATCCAGA
ACCTAGTTGAGGCGTCGACCACGAAGAGCCTTGCTAGTGGTGTCAGTGGTACCAGTGGTGCCAGCGGCAGCAGTGCTGCC
AGCGGCGGTGGCAGCAGCCTGAACCCGGTCAAGAAGTACAAGGATTTCAAGGATCGCAGCCGGGATCTGCACCGGAAGCA
TAGAGGTTTGATGCAGTGGTGAGTGTTCTTTTTTTTCTTGCAATTTTGACAACGGATTATCAGTCTGGCTGACAGCTCAG
GAAACCTATGCGCAACATTGCATTTGCCAAGGACGAGGCCACGTTTGCAGTGCGGCGCGCACTCAAGGTCGGTAAGCTGG
AGGGCCGAACACCAGACATTGAGACGGAGGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62