GenePrediction:GLEAN_2009 Details

Name: GLEAN_2009
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:85839..95026 (+ strand)
Length: 9188
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:85839..86545 (+ strand)
Length: 707
Type: CDS
Source: GLEAN
Position: GCSC_108:86708..86811 (+ strand)
Length: 104
Type: CDS
Source: GLEAN
Position: GCSC_108:87001..88300 (+ strand)
Length: 1300
Type: CDS
Source: GLEAN
Position: GCSC_108:88412..88833 (+ strand)
Length: 422
Type: CDS
Source: GLEAN
Position: GCSC_108:88902..89010 (+ strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_108:89069..89907 (+ strand)
Length: 839
Type: CDS
Source: GLEAN
Position: GCSC_108:90266..90522 (+ strand)
Length: 257
Type: CDS
Source: GLEAN
Position: GCSC_108:90903..91061 (+ strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_108:91265..95026 (+ strand)
Length: 3762
>GLEAN_2009 class=GenePrediction position=GCSC_108:85839..95026 (+ strand)
ATGCTCACGGCCTTTACTGCGCGGCCCATTGTCGAGCTCAAGGCACGCGACAAGTCCCGGGTCCAATCGCTTGTGGCCTA
TGGCGATCGTCTGCTGGTGGGCCTGCACACGGGCGTGCTGCGCATCTACCGCGTGAACGAAGCCGACCCGACGGCGACGG
CAACAGCTGCGAGCCCGACGACGTCAACATCGATGACAGCCGCCAAAGACTCGGCCGTCGCCAACCCGCCCACGATTCTC
CTCCGCGAAGTCGAGAAGTTCGCCAGCCGCTCCATCGAGCAGCTGGCCATCATCAAAGAGGCCAACACGCTCGTCTCGCT
GGCCAACTATGCCGTCTCACTGCACGATCTGCAGACGTTTACACCGCTGCCCGGGGCTGCACCGCTGCCGGGAACCAAGA
ACGCCAGCGCCTTTGCCGTGACGAGCAACATCGTCAAGGACCCGGCCACGGGTATCCCCGAGATCGTGTCGCGCCTCGCC
GTGGCTGTCAAACGCCGTCTGCTTCTCTGGACCTGGTATGCGAGTGAGCTGAGCACGGGCGACGACCGGACCGACGATGG
TCGCAGCAACGTCGCCGCCGGAAGACCACCCCCGCCGCCCGAGATCACGCTACCCGAGACCATCCGCTCGCTGACGTGGG
CCAGTGCCACGAAGCTTGTGGTTGGCATGAATGCCGGCTACGTCCTCGTCGACGTGTTGGCACGCACGTTTGAGGACATT
GCCGGCGGCGGCAACAGCGCCAGCAACAACGGAAGCCTCAACGGCAACGGCCACGGAAACGCAAACGGCGGCAGCAGCGA
CTTTGCCGCCAGCACCAGCCGCTTCGGCGCCCTTAGCAGCGCCGGCATGGGCTACATGGGCCTCGGCAGCTACATGCCCC
GGCCGCTGGCGGCCAGGCTGGCCGACGGGGCCGTGTTGTTGGCCAAGGACGTTCACACCATCTTTGTCAGCGACCAGGGC
CGCACCCTCGACCGTCGGCCTATTCCCTGGACCGGGGCCCCCGACAGCATCGGCTACAGCTATCCGTACATTCTGGCGCT
GCGGCCACCCGGCAGCGAAGCGGCTAGCGGCAACAGCAACAGTAACAGCACCAGCAACAGCAACAACAACAAAGGCAGCA
AGGATGGCAGCAGTTCTATTGTTCCTGGCCCCCCACCTGCAGGCGTGCTCGAGATCCGCAATCCCGACACCCTCAGCCTG
CTGCAGACCATCCCGCTGCCGGCCCCAGTGGTCGGTAATGCCGGCACGCTGCAACTGCACGTGCCGCCGCCTTCGGTCAG
CCTGGCGCACGCCGGCAAGGGCTTCCACGTGGCATCGGAGCGCGGCGTCTGGAAGATGGACGCGACCGGCTACGACAGCC
AGGTGGACGCGCTGGTGGCGTGCGGTCGTCTAGACGAGGCCATCAGCCTGCTGGGCCTGCTGGAAGATGCGCTGCTGCGG
GACAAGGCGCAGACGCTGCGGGCCGTGAAGATGCGCAAGGCCGAGCAGTTGTTCCGACAGCGCCGCTACCTGGACTCCAT
GGACCTGTTTAGCGAAGAGGACGTGCATGCGCCGCCGGAACGGGTGCTGCGCTTCTTTCCGCGCTCGATCGTCGGCGAGC
TGTCAGACGAGGTCCTGGAGGAAAAGAAGGACGAGACAGAGGAAGTGGCGGTGGAGGACGACAACGAGGGGGACGCGTCG
GCTGCAGGGTCATCCCCAGAGGCTGACGCGGCCAAGGATACAACGGCAGAAGCGGCAGGTATCAGCGGGAAGGAAACAGA
CGGTAGTGAGAGCAGGGAACAGGCACCACAACCATCAGAGCAGCAGCAACAGCCGCCACAGCTGCCGTCACTGCCACCAC
TACCAGCCGAGGTAGCTATATCTCTGCCCAAGGCCAGCGGCTTCACCAAGATGTTTATGAGCCACCGACGCACAGACTCG
GACGCGGCATCGACTCGGACGAACACGTCTTCCGTGGCCAAGGGGCCCACAGCAGCGGTGGCCACGGCAGCCGAGGAGGC
AGGCGATGCAGAGAAACCTGCTACTGCCAATGGTTATGTTCCGCTCGAGGGCAAGGACCTAATGCGGGCGGTCGAGGCGC
TCAACAGTTACCTGGCGGGTGCGCGGGCACGGCTTCAGCGGGAGATCGACCCGGCAACAGGCAAGCTGAAGGAGAAGAAG
GCAGCGTCGGGGGACAAGAACAGAAGAACCGAAAAGGACGAGGACGAGGACGAGGATGACGAGGCGCGCGAAAAGCGACT
GCGAGAGGCATTCACGCTCGTGGACACGACCATGTTTCGGGTGCTGATGCTGATCCGGCCAAAGCTGGCCAGCTCGCTGT
TCCGGATCCCCAACTTCTGTGACCCGGCCGTGGTCAACGAGCGGCTGCTGGAGCGCAGCCGATTCAACGAGCTGGTAGAC
TTTTTCTATGGCAAGCGGCTGCACCGCCGGGCGCTTGAGCTGCTGCGGGAGTTTGGAGAGGGGTGCGAGGAGGACCGAGA
GAAAGAGAGAGAGAGAGAGAGCGAGAGCGAGAGCAAGATCGTCGTCCCGCCGGCTCTCCGTGGACCCCGGCGGACGGTGG
CCTATCTGCAGAGCCTGCCGCCTGAGATGGCCGACCTGGTGCTCGAGTTCTCGGCGTGGACGCTGCGGGCAGACCCAGAG
CTCGGCATGGAGGTGTTCCTGGCCGACTCAGAGAATGCAGAGTCGCTGCCGCGCGACCGGGTGGCCGGCTTCCTGGCCGA
AATTGACGCCCGGCTCGAGATCCGGTACCTGGATCACGTGATCAACGAGCTCAACGACCTCACGCCAGCCTTCCACAACC
GGCTGGTCGACCAGCGGATCCGGCTGCTGCAGGAGACAGACCGGGGCAGCGATGACAGCGGCAGCGACAGTGACGACAGC
AATGCCAAGGCAAGACGGGCCGACTGGGACACGGCCATGGCCAAGCTCGTGGCCTTTCTCAAGACGAGCCGACAGTACAG
CCTGTCGCGTGTGTTTGGGCTGATTCCACGCGACGGTGGGTGCTCCTTCTGTATCGGGGTTCTGTCTGATGACGCATTGC
TTACTTATTCTTTACTTTGCTAGACGCTGCCTTTTACAAGGCACAAGCCATCGTGCTGAGCAAGATGGGCCAGCACAAGC
AAGCGCTAGAGATTTACGTGTTCAAGATGAAGGACGAGGTCGAGGCAGAAGAGTGCGTCCGTGTTCTGTGTTGCTGTCGT
TCTGTGGCGATTTATATGCTGACTAAGTAGATACTGCAACCGCATCCACGCAGCGCGAGAAGCAGCACGGAGCGCAACCC
AAGCAGCCCAGCCGGTATCGCCACGGCTCGGCGCCGCCACGGGGACAGGAGCGAGCGGTCGACGGACGCTGCGACACGCG
CTATCGCGCGGATCGGCCGACGACGGGACATCAAGCATGGGGCCGAGCGCGAGCGTCAGCGTGAGCGCGGATGCCGACAG
CATGGACGAAGACGACGAGGACGGGGATGCAGACACGAACAGCGGGACGGGTGGTGGTAGTGGTGGTGGCGGCAGCAACA
GCTACGGCTACAGCTACAACCACAGCTACAGCTACAGCAACAGCAACAGCTACAGCAACAGCAACAGCAACAGCAGCCGG
ACACCCGGAGGAGCGGCGACGCCAACGGCAACAGCAACAACAACGACAGGGGGCCCATCGATCTACCACATGCTGCTATC
GCTGTACCTGACGCCGCCGTCGCCACACAAGCAGCAGCTAGGGCCGGCACTGGACCTGCTGTCGCGACACGGAGCGCGGC
TGCCGGCATCGTCGACGCTGCGGCTGATCCCCGAGGGGCTGCCGGTGGCAGAGCTGGCGGCCTACTTTCGCGGACGCATG
CGGGCGACGCACAGCGCGGTGCACGACAGCCGGATCGATCGGGGCCTACGGCAGACGGGCGTCCTGGCGGCACAGGCGGC
GCTGCTGCTAGGGGCCGACGGCAGCGGACGGGCCGGGCGAAGCCGGCACGTCGTGGTGGGCGAGGAGCGGGTCTGCGGCG
TGTGTCACAAGCGGCTAGGCGGCAGCGTGGTGGCAGTACTGCCGGATAACGCGGTGGTGCACTATGGCTGTCTGAACCGG
GCGGCGGGGAAGGCATGGGGGAGGGGGTAGGGGTGAGATGAGGTGAGGGGAGATGGGAGAGAGAGGAGGGAAGAGAAGAG
GGAAGAGATCGGAGAGGAGGGACGAAGATATGGGAGAGAGAAGACAGGGAGAAGGAGAGGGAAGAAGATGAGAAGCGAGA
AGAGAAGGGAAAGCGAGAAGAGAAGGGAAAGAAGAGGAGACAAGCGAAGAAACGAGAACACACAAGAGGACAGACTGGAC
AAGGATGTCAATGTAATGGCGACAATTCTGAGGGCTGCAAATATATGCAGTCGATATGTATGAATAGAACAGGGTCCCAC
GCCTACTCAACCATCTCCTCGCCGTAGCTGGCCTCCTCCTTCTGGGCGGCGGCGGCGTCCTTGGCCGAGCGAGTGGCGTC
GACCACCATGCGGGCTGTCAGCTCGCGGTTGACGTCGGCCTGGACAGCAGTGACGGCCGCGCGCAGACTGGCGAGATGGT
CGGCCTTGGTCTCGGCCGTCGACAGCGCGGAAACGGCCTTGAACGAGTCACTGTCGGGGCTGTGGTAGACAGCCCGGAGA
GTGGACTGGGCCATGAGTCGTCGGTTGTTGGTGGGTGTGTGGGAGTGAGTGCGTAGGTGAGAGTGCGTGGGTGTGTGGGG
AGAGAGTTGGAAATAGTATGCAATGAGTCTACGAGTATTTTACAAGTGCATCCATTCACGGAGTATTCCGTAGATTTGAC
AGTACCGCCTGGCACAATGGCAGCATCTAATTGGCTAGACAGAAGAGATAGACCACCCACTTTAAGGCTAAAGGCTAAAG
ACGACCGCCCCCCCCCCCCCACTCACGTGTGGGGTCAGTCACGTGGACCTATACCTAGCACAACGTATCGTGCCTGCCGC
AGAAAGCTTTCCTGGCCATGCACCCTGTGCGCCTTCCCTCCCGTCGTCGCCCCAGCTCTTGCCCTCCTGCCCGTTTCTGT
CTGCCCAAAAGATCCGCTCGCCAGCCAGAAATCCTGATCGATCGCCACCCGGACCAGAAGGCAGAAAGGAGACAGATTGA
CGATTGCCAGCCAGGAACACGGCCATCTCTCGCTGGCCCCGACCGAGCCCAGTCCGAGGGGAGCGAGGGGGAGCCGCCAC
CACCACCGCACGGTGCTAGCAAAGTCAGCAAGCCGCTTCCTTGGCACGCATCCAATCAGCCCAAAGGCCGCCGAGCATCA
ACAGAACAAGAGAAAAACGGAGAGAGAGACAAGGCCAGGCCGAGAGAAGACAGAGACGCCAGAGACACGGCCAGAGAAAA
GACAGACGCGGGACAGATGTCCGGTCAACGCTGACCACCCTCTGACACGCACACGCTGCTGGACAGGGCAACACTTGTCA
CGAGCCGATCTTTGGAGCCGGAAGCCAGGCGAGACGACTCTGTTCTCGGGCGATAGTCATCGTCCTGCTCGCCATGCAGC
CGTCTCGGGCACCGCGGGGCCCCGGCAGCTTCTCGCCGCTGCCGTCCCTGTCCGCATCGGCAGCCTCTGCAAATGCTGTC
GCCTCTCCGCCCTCCTCGCCCGAACCAGCCTTGGCCTATCCGCCTCGACAGACTGCTCCGGCCTCACCCTCTTCCTCGGC
TCGCTCTGTCGGCGTCCTGCCGCCCCAGCGCTCTCCCCGTCCGGCCGGACACATGCGATCTCGCCGTATCAACTCCACCT
CCAGCGACGAAGCCCTTTCGGTCATGCCGCCTCCCCTCACCATAAACAAGGGCCGCCAGCCACATCAGCAACAGCAGCAC
CAACAGTCACAACAATCACAGTTGCAACCACAACAACAACAACAACAACAGTCTACCCCGTCTTCCTACGCCTCTTTTGC
TGCCGGTGCTGCTTCGGCTGCCGGCGTCTCTCCCTCCACCCACAACAACTATTCCCGTCCGGCAGCACTGGCAACATCGG
CTGCTGCTGCTGCGACTGCTCGCCAGACCGCTGCTGCCGCTGCCGCCAACGATGCCTCCCGTGCCGTCTCACCCCTGACG
CTGCCCAACAGTGCCGCTCCCAGCCCGAGCAGCAGACACGAGGGCGCACCTCCAAGCCCCGTCACGGCCTTCAAGCCTGG
CCCTGGTCACTCGCGCAAGCACTCTCAGACCGCTGGCCATTTTGACGCCACCTTGCCGTCCACAAATAGGGCCCAACAGC
AGCAACAGCAGCAACAGCAGCAGCAGCAGCAGACGACCACCACGTCGGCAGCAGCCTATGGCAGACCCGGCGGCAGATCG
ACGTCTTCGCCCCCTCCTCCCACCCTGAGTGCCAGCCAGATTGCAGCCCAGGCCGCCGTTCTCCATCAGCAACAGCAACA
GCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACACCAGAGCC
AGATGCAGAGCCAGAGCCAGGGTCAGAACCCACCACAGACCCAGACCCAAGTCCAGACCCAACACCAGAACCTGCATCCC
CACCAACACCAGCTGCAACCACAGCAACAGTCCCACCAGCAGCCACAACAGCCGCAGCACACGCGCCAGCGGTCACAGAC
TGTGCCCACGCCCGGCGAGTCGTGTGAGGCCGCTTTGGTCCCGCACAAGAGGAGCAGCGTCCTCGCTGCACCGCCCACCC
TCAGTCTGACCGAGGCCAGCGGCCCCAGCGACAGCGGCTTCGACAGCATGTCCTACCACAACGGCCTGCTTGGCGGTCAC
GCCTCGGCCGCCCAGGCTGCTGCCAGTGTCGTCTTCTCCCGGTCTGGTGCGCCGGCCTCGCCCAGCGCCACGTCGCCTCA
GCAGCACTCACCAAAGCAGCACTCGCCAAAGCAGCAGCAGCACTCGCCGAAGCAGCAGCAGCCGCCGCAGCAGCAAGCAC
CCCTGCCGCCTATACCACCGCCTCCACCGCTACCGGAGAAGAAGCTGGAGAAGAGCAAGGTCAAGCTCTTCTCGCGCCCG
GGCAAGATCTCGGTCAAGGGCGAAACTCGAGACAAGCCGCTGCCGAGCCCCAGCAAGATGGGCCTCTCGTCTGCCTTGGC
GTCGCTGCAGCGCGGCAACTTCAGCACCACCGCCGTCGAGTCTCTGGGCCAGCCGTTTTACAGCATAAATAACTCTTCGG
CCGCAACGATCCGACCGTCGGACCCGTCGCTGACGCTGGGCCTGAGCAGCGGTCTCGCCAGCAGCAGTAGCAGCAACCTC
GGCGGTATACCGGGTGGTGCTTCTGGCATGGGCGGTGGCAGCGGCGGCGGCAGTGGTGGTGCTGGCATCGGGATCGGCAG
CAGCAGCAGCAGCCTGACGGCCGTGCCGGAGAAGGAGGCCAAGGAAAAGAAACACCACTTTCTGTCGCGCCAGAAGCACA
AGCTGGCCAAGGACAAGGACGACTTCCACCTGCCGCTGTCGTCGGCTGCCAGCAACTCACGGCCCACCGATCCTCACGCC
CCCAACAGTCTCTACAACTTCAGTCTCCCGGTGGCCAGTCCCGGCCCAGGCGCGACGACCTTTAAGGGCATGAGCGCGCT
GGACCTGCGCCACGGCGGCCGGGGCCTACGCGACAAGAAGAAGGAGAAGGAGGAGAAGGCGGCGGCGGCGGCGGCGGCCA
GCGATGTCGACGGGTCCCCGAGCGGCATAAGCATCAGCGGAGCGGGTGCCGGTGGCGGCGTGGGAGGCGGTGGCGCGAGC
GACTGGCCGGGACCCGGCAGCTTTGGCTCGGTCGGCGGCACGGCCTCGAGCTTTCTGAGCGAGACGGCCGCCGATGCGGT
CAAGTTCGGCTTCAACAATCTGAGCTACGACGACGCTTGGCCGTACCTCAAGGCAAAGCTGCAGGTTATCTTCGAAGGCG
AGGACCTGCGCATCCCCATCGAGCACCTCAACCGCATCGTCATCATGCACATCCAGTACTGCATCCAGCGCCGCTCGCCC
AGCATCATTCTCGAGGACCTGCGGGACCTGCTGGCCGCCGGCTTTGCCTCGCTCGACCGCACCCTGCGCAAGACGCCCGA
GGACCGCCTGATCCCGGCCCTGGTCGAGCTGTGGCTCTTCACCTTTACGAGCATCCTGCCGTACATGCAGGCCGTCTTTC
CGCCCCTGGACCTGGAGTTCTCGGGCAGTGGCACGCTGCTGACGCCCGAACAGGCCCGTGACTTTTGGGGCAGCGTCGCC
GGGACGACGACTGGGACGACTGCAGGGACGACTGCCGGGACGACTGCAGGGACGACTGCCGGGACGAATGCCGGGACGAA
TGCCAGCACAACAGCGGGAGCCGGGACCAATGCAGTGACTCCGGTCTCAGCCGTGCTCGATGTGCGCCGACTGGTGCTGG
CCTCGTATCGGGACGCCGTGATCCTGCCGCGCTACGACACGCTCAAGCCCATCTTCTCGCGGCTCTCGCTCGAGTTTCTG
CCTCAGTCGCTTACCGGCATGACCAAGACGCACAAGACGCACAAGACGGCCGGATCCACGTCGACGCCCATCCCGATCAA
GCAGAAGAGCCGGTCCAACTCGACGCTGGCCCAGCAGTACCAGACGGCCGGGGCGCATAGTTACGGCAGTTTCGGCGGTG
GTGCCAGCAGCAGCAGCTATCTACAGCAGCAGCAACACATGTTGTCGACGTCGCCAGGGACGGCCGACATCCGGCCGGGA
ACGGCCATGAGCGGGGACCCGAGCGTTTCGGCCAGCAGCGGCAGTGTCGGCGGTATCGGTGGTGCCAACAGTGGAGCAGA
CGGCAGCCGAGGCCGAGCGATCAGCAACGTGTCGTTTGGCAGCGGCAGCGAGCCGAGGCCGACGTTCTCGCTGGGCAACA
CAGCCAACGCAGGTGCCAGCATTCTGCACGGCAGCCTGCGGGAACAAAATGTGGAGGACAGCAAGCAGGTGACGGAGATG
GTCGGTCGCATACTGCAGTGCATGAGCGTACTGGCCGGCGTGGGTGTGGCCGGCGATGGGAGCGACGAGGGCAACAAGAT
GGTGGAGGAGCTGAACCGGTTGCTGAAGCTCAACTGGCTGGGCCGTGGACGCACAGGACGCAACCGACGCGGAATGGTGG
GCGGCCGAGTGCGGCGAGCCGGCACCGGTGAGACGGCAGGGACACGGGACACGATGAGCGTTAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62