GenePrediction:GLEAN_2010 Details

Name: GLEAN_2010
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:97304..100037 (+ strand)
Length: 2734
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:97304..97622 (+ strand)
Length: 319
Type: CDS
Source: GLEAN
Position: GCSC_108:97703..97884 (+ strand)
Length: 182
Type: CDS
Source: GLEAN
Position: GCSC_108:97944..98576 (+ strand)
Length: 633
Type: CDS
Source: GLEAN
Position: GCSC_108:98772..99092 (+ strand)
Length: 321
Type: CDS
Source: GLEAN
Position: GCSC_108:99157..99471 (+ strand)
Length: 315
Type: CDS
Source: GLEAN
Position: GCSC_108:99534..100037 (+ strand)
Length: 504
>GLEAN_2010 class=GenePrediction position=GCSC_108:97304..100037 (+ strand)
ATGATGGCGAGCATCGGCGCGGCTTTTCCTCCTCACCCTGGCGCCATGCAACAACATCCGGGCGTTCCCCAGGGCCACCC
CGGCCTTGCTCCGGGCATGGCTCACAACCCGAGCCAACCAGGCGGTCCGCCGGGCTCTGTTCCGCAACACCTCGCTGCCG
CCCACATGGGCGTCTCCGGTCCTGGACCCCAGATGAATCCGGTCGCCATGATGGGCATACCCCCTGGAGCCGGCCCCAAT
GCGCATGCAATGCAGCATCTCACCCCGCAGCAGCAGCAGCAGCTGCTCCAGCAACAACAACAGATGGGTCAGATGGCCTG
TACGTCTTCCCTCCCATTCCCTCCTCCCTTCCCCTCCTCTCTCCCCTAATGTCCGTGCGGTCTGACGCGTTTGCAGTAGC
CAATAATCCCAACTTTCAGCTGCAGCAGCAGCACCGCTTCCAGATGCAGCAACAGCAGCAACAGCAACGACAGAACCAGC
AAATGCTCATGCAACAGCACGGCATGTATCCTAGCGGGATGCCTATGGGCCCGGTGAACATGAACCAAATTGCCGCTCTC
CAAAGACGGATGGCCGGACCGGTAAGCATCCCTACCCGGCGTCTTTCCGTACAATCACTGACACCTCATGCTCGACACAG
CACGCTCAGGACCCGCGCGCCCAAGCATTCCTGGCACAGCAAATAGCCATCCAGCAGCAAGCGGCTGCACAAAGCCAAAA
CCCGAACGCCGGTCAGCTCAATCTGCACCAGGCCCAGATTGCCGCCCTCCAAGCACAGCAAGCGCAGCAAGCGCAGCACG
CTCAGCAGGCCCAGCAGGCCCAGGCTCAGCACGTGCAGCAAGCACACCAAGCACACCAAGCACAGCAGGCGCATCAGGCT
CAACAAGCCGCAGCCGCCGCTGCCCACGCCCAGCAGCAGGCTCATCAAGCTCAGGCACAACAGCAAGCCCAACAGGCCCA
CCAGGCACAGCAACAGGCACAACACCAGGCACAGCAGCAACAACAGCAACAGCAGCAGCAGCAGCAGGCACACCAGGCAC
AGCAAGTCTCTCAAGGACAACAAACCCCCGGCATTCCCGGCCAGCCACAGGGGCAACAGCCAACTCCAGGCCAGTCTCAG
CCGCAAACACCTCAGCCTACTGGTCAGCCGACCGTCGGCCCGCCACCTCAGAATGCTGGGCCTCAGGGTCCGCAAATGCA
GGTACCGCCTCAGATGGCCGGCAACGCACATCAACAGCAGCCAGTGTCCGGCCCGCCACAACCACCGATGCCCGTCCAGA
TGCCGCAGATGCTCCAGCCTAATTCGCTTACCCTGCAGCAACATGCTCAACAGCAGCAGCATGCTCAACAGCAGCAGCAT
GTCCAGCAGCAGCAACAGCAGCAGCAGCTCGCCGCCGCCGCAAATGCTGCACTCCAAAAAAGCCCGCCAAGGCTAGCATG
CTTGGTCAGACTAAACCAGTTTTGCGAGCACATCGCCGGCTTTCCAGGATCCAAGGGCAAAGACGACCTCTCATACTGGG
TTAACCTCGTTCATCAGTTTTTTGCCAGCACCGGCGTGTTTCGTCACACCATCCATATCGTCGAAGGCGATGAGAAGACC
ACCAACAAGCAATTCGAGATTCCGTTTTCCGCACTACCCCGCTACTTCCATACCTACTTTGAGAGCGGCGTCACAAAGCT
TCAGCTGATCATGGACAACGCCGTCGTGGAAAAGCCGCCGGTCAGCGACCGATTCTGCGTCGAGAACTACAAATCCAGTT
TGGTCCAGTGGTTTGAGAATGGCGGACACGTACGTTTCTTCCCATTGCTGCAGGTCACGGGTATCGTATAGTCGAGCTAA
CTGTGGCAATCAGGTCGTATCCACTGGCACAATTCGCGCGCAGTTCGACCCGGAAGTCAAGATGGACTTGTTTGAGTTTG
TCTGCGATGGTCATGAAGAGTTCGTTTCTCGGAAGCTCGTCCTTCAAGCTGCCAGACCGGGCCACAACTGGCTAAAGGAG
TGGAACAAAGTCAACAGCCCGCCCGACAGCAAGCAGTCGCCGGAAATGAGCAAGAAGTCAAAGGCCAAGCAGTTGAAATC
TCCACAGAGCCAGCCACCAGCTTTTGATCTGCCGTCTGTCATCGAGGGCAACGCTGGCCTGACTAGTGCCATGAAGCAAT
TTCTTGAAGTAGGCTACCAGCTCTCCCCTGCAGCCTGTCAAGTAAGAATCCTAACCAATGCTTTTTGCAGATAGTCGAAG
TGATGGGCTACATGAACTCGCTCTTTGGCTTCTCCCATGGAAATCCGACCCTGACAGCATTTGGTGCCCTCGACCAGTTT
GTGCAGACCGTCTGCACAACATCCAATGGGAATGTGCCGATGATGATACCACAAGGACCTCCACGGACTCCTAGTATGGG
GTTCCCCATTGGTGCCAGCCCGCATCTAACCCATCTACCGCCTCCGGGTTCACCACACGTTATTGGCAGCCCGGCAGCTG
GCGTAATGCCAGCGCCTTCAATGCATCGGTCGCAAAGCCAACAGGGACCCGGCTCTAACGTCGCCAGTGCCAACACTTCG
CCTGCGGGAACCAAGCGCAGACGGCCTTCTGGCGTGAAGACGGAGGACGAAATGAACGGCGGGCCTACATCAGTCCCAAC
TCCATCAGCCAACCCACAGGCAAACGGCCTTCAGGGTAAACCGAAGCCACCCACACCAAGGATGCAGAAGAAGCAGAAGG
TGAATCCGACGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62