GenePrediction:GLEAN_2011 Details

Name: GLEAN_2011
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:101861..108716 (+ strand)
Length: 6856
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:101861..101982 (+ strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_108:102063..102280 (+ strand)
Length: 218
Type: CDS
Source: GLEAN
Position: GCSC_108:102357..102973 (+ strand)
Length: 617
Type: CDS
Source: GLEAN
Position: GCSC_108:103244..103325 (+ strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_108:103429..103577 (+ strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_108:103869..103895 (+ strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_108:103958..104042 (+ strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_108:104151..104974 (+ strand)
Length: 824
Type: CDS
Source: GLEAN
Position: GCSC_108:105034..105470 (+ strand)
Length: 437
Type: CDS
Source: GLEAN
Position: GCSC_108:106198..107901 (+ strand)
Length: 1704
Type: CDS
Source: GLEAN
Position: GCSC_108:107958..108021 (+ strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_108:108072..108339 (+ strand)
Length: 268
Type: CDS
Source: GLEAN
Position: GCSC_108:108406..108716 (+ strand)
Length: 311
>GLEAN_2011 class=GenePrediction position=GCSC_108:101861..108716 (+ strand)
ATGGCCGCCGTGTACAAGTCCCTCGCCAAGGTGAGCGGCGACAACTCCAAAGAGGATGGCGTGGTGAAGCGGAAGAACCG
GCAACGTGTGCTGATCCTCACTTCTCGGGGCGTCACATACAGGTTCGTTGATCTTGGTATTCTCGGTACTTGGTGTTGTG
CTGCTGCGATTGTAGCGTACATGTGCTGACAGAAGACTCTAGACACCGGCATCTTCTGAATGACCTGGCAGCTATGATGC
CGCACAGTCGGAAAGACGCCAAGTTCGACTCCAAGTCCAAGCTCTACCAGCTGAACGAGCTGGCTGAGCTGTACAACTGC
AACAATGTACTATTCTTTGAGGCACGCAAAGGCCAGGACCTGTACATGTGGATGAGCAAGGTGCCGAACGGACCGACTGT
CAAGATGCACGTTCAGAACCGTGAGTATCTCCTCTTTGAACTCTCTCTGCGTACGCAACGCCGTGTCGCACGCCCCCTTT
GCTGACGGACTCGCAGTGCACACGATGGAGGAGCTTCACTTCACCGGCAACTGCCTCAAGGGATCGCGTCCCGTTCTCTC
GTTCGATGCCGCCTTCGACTCGGAGCCGCACCTGCAGCTGCTCAAGGAGATGTTTATGCACACCTTTGGCGTACCACAGG
GCGCGCGTCGCTCGAAACCCTTCATCGACCGGGTCATGGGCTTCACGGTTGCTGATGGCAAGATCTGGATCCGCAACTAC
CAGATCAGTGAGGTCGAGGTTGGCAAGGTCGCCGGCGGAGAGGAGGAGGACGACGACGCCAAGACGGCCAAGGCGGTCAA
GGCGGCCAAGGCGGCCAAGAGCGCCAAGTCGGCAATGAAGGACACGGACATCACCCTCGTTGAGATTGGACCCCGGTTTG
TCCTCACGCCCATCGTCATCCAGGAGGGCGCCTTTGGCGGCCCCATCATCTACGAGAACAAGCAGTTCGTCTCACCCAAC
CGGGTGCGGTCAGATCTGCGCAAGAATAAGGCCGAGCGGCACAACGTCCGCGCCGAACAGCAGCAGGACCTCATCCAGAA
AAAGAGCAGCCTTGGCCTGCAGTCCAAGGGCGGTGCTGGTCCGGCCAACCGTGGCGTGCTGGACACAAAGGAGGTCTTTG
CGTAAGCAGGCCGCACTCTTCTTGTCTTGCGTGTACTATCTTCATCACTATTGTCATTTGTCACGATTCCCACAGGGCGT
TTGGGTTGCAATTGGACATTTTTAGCCATTGCCTCATGTGAGAGAATGCGTGTTAGGCGTGATAGGCTTATTCAAGTTTC
CATGGGTTTTCGTTAGCTATGTTTGACACGTGACCATGTTCGGGATGACGGAGGACCCGCATTTGCGATCTTGCTCCTTT
ACCTGCGCGCACGCGAATCTCAGACTGTCTTCTTCGTTTTGTTTCCTCAACTCGCCGTCAAGCCCGCGGTCAACCAGAGT
GTCGCTGTTGCAACCCACCCGCTCTGTTCGTTCCCATCCCTGTCGCACAGTCGTGTGAGGAAACTCTTATTATCCCTTTT
TGAATATGGCGCATTACCCCTTGGATACGATGACAGGCCATTTAACAGGTCAATCGGCGCGCGACGAGACGAACACCACG
AAGAGCATCATAAACATCAACACCAACAACAAATCAAGCAACAACATTACCACCAAGAACACATACTTTAGTCATGCCCA
TTTCACCCCATATGTCCCAGATAGCCCCAAGTGCGGGGTGCGCGTATAGAACTGACAACGTGGAAGACGACCTACGCGAT
TCGAGCAAATAAATCGAGTCATTTTGAGTCGTTCGAGACTTGTTGTTTTCAATTTATAAGAGAGTAGAAGAAGCCTGCTA
TCATATTCTCGCAGCGAAACCAACCAATTCACATCACAACAGTTCACCTTAGTCTTTCCCTCGGCTATAAACGACTTATA
CTTTGTCTTAACAACCATTTTGAAAGCCAATATTCTCTCCATCTTTTCGATTTTTAAGAACAAAACCACAAATTGCTCTG
CACTACAGCTTAAGCGAGGCGCACGGGTTGCATTTGTGAGTGCTTGTAGCGACTGCCTAGCTCGCTATATCACTAACACG
ACTCTTGCACCATGCAGACCCCACACCAGCTAAAGAGCTTCAAGCTGAAGCTCCTGAACGCTTTCTGGAAGGCAACTTTC
TCAACCACCTTCCTTGGCACCTGTTACTCCCGTGTACCTGGTGCCAAAATACTTTAGGGCTCAACTCTTTTGTTCCTCCT
CTTGTTATTTCTTTCACTGGGACTATCGCAGACCACTATGTCTGTAGCAGCTTGTATGCTATTGCCACGAATGGTACATG
GCACACCGGGGAGTCCGGCTATGACCGCAGCTACTGGACTGCTCCCGGCTGTTGCTACATTGCCATCACCCGAAGTGCTG
CCGTCTGCCCTGGACCGTGCACCAGTTGAGGTGCTCGTTCTTGTGTTTCAGCACCTGGACCTGGATGCAGCATTCAGCCT
AGCTGCAACGAACAAAAGACTCGACCGCATTTTCACCAGAAATCGGGCCGTGATCGTGTTGCGTATTGCACAGCGGGAAT
TCAGCCCGCTGAACGGCTTATTGCAAGTAGCCAAGGCATCGCCAGCAGACATGGCTGTGCCCTGGGGCACGTGGCTGGAC
AAACGAATTCGACGGAAGAACGTGGTACTCTGTTCAGGCGGCGTGGCTGGTGTTGACAAGCGGACGAACATCAGCTTGGT
CTCGTCGTTGGCGAACATTCGCTGTGCCGAAGCCGAGATAACGAATGCGGACATCGACCGCATACTGGATGTATGTCGGG
TGGTGCGCGGGTGGGAGCGGATCTTTCCCCAACATCGGTTCAACGCCTCACCTCTGCTGACCCGCAGCCTGACGGAAAGG
GAGAACTTCCGGCTGCGTCGGGCGCTGTATAACTGGATGCGCTATGCATTCTACTTCCATGGCGATCTGCCGCGGCCAAA
CGTGTTTGTGCCGGCCGGGAGGGATGTCCGGGTCAACCACCTGCGGGCGCTGTGCAACGGCCAGTTGGGGGAACTGGCAG
ATTTGTGGCGCACGGTAGAAGACATCATCGAGATGTCGCTGTGTCCTTCGGTCGACATCGTTCGTATCGGCGCAGTAAGT
CTGTCTTCTTTGGCTGAGCTAGGCAGTTGCATGATCGATTCTGACAGCAATAGGACTTCCAGATATCGGAGAAAGCTGCG
GCTGAGATCGGCTGGGGTGAGGAGAGGGAGAACAAGACTGTAGTGGCGACAATGTCGAAGCTGTCTCCACGGCAGCTGCT
GCACTATCTTGACAATGGGCACAAATACACCAAGGTGCGACTCATCGCAGACATCCGACAACGCATGGCACATTTTGAAT
CAGACACGGAGAGCCTGACGAGCGCGATGTCGGTGGTGAGCATGGAACGGTGGCGGCAGATGCAGAGACAGTTTCCAGCC
CTGGTTCAGGGCACGGGATCGCGGGTGTTTCTGCCGGTGTATACGCGGGTGATGAGCCAGTTCCATGGCGGGACGTTGGA
CTGGGACGATGCACAGACAGAGATAGATCTGGAGCGGATTGGCAGGATGGTGGGTGTAGGATTGGATTGGCGACCGGAGG
AGTTCTTTGGGTTCCGGCCTGAGATTCCAACGGGAATGCTGAATCCTTGAGATAGCGGTAGATGCACATAGCTTCGAGCT
AGCTCTTTAATCTGTACAGGAAGGAGCGTGTTTCTAAGAGTTGCGTGCCTGCACAGTAAATGCGACGTCGTTCATAGCAG
GCGGGCCGCTATCAGGTGCCCCGCCAATCAGGCAAGGGCAGGCTTCCCTGGACAAGCTAAAATGCTAACCAGCGCTTTGT
TTTCACTCGTCGCCTCTTCTGCCCAAACCCATCACAAAAAGTGACAACACGACCGCAGCTCCACCAGTGGCGATCCTCGG
TTAGCCACGTAGCTTGCTATTTTGATTCATCAGACAGCCACGACAGCCTTGTTTTGTGAACGAGGCCAGGAGCCAGAGGC
CAGTGAGCACACCGGTAAAACAGCTTTCTCTCATGTGGGCTGTGGAGGATCAGTAAAGGTATGTTATGACAGCTTTTGGG
ATTTCGGTCTTACCCCTTTCGTCGTCGGTACAGGGCTCCGGCAAGCGCCAGCCTTGGCGGTCTTGAAGTGGCCGGCAGGA
CAACCGGTGCTCTGCTGTTTGATTCATCCGTGGAATGGGTTGACAGCGTGCATTGGCCGTCCTTTCTGCCTGTTTGAATT
GTGTTTCAAGCGATTTGCCCTGGCAGTGTGCGATTGCCAGCTGTCTGCCATAGACAGCGTCTAGTTCTGAGTGGTACTGG
AACTGACCGTTGACCAGGCCACCGTCTCGTGTTTTCGTCTCATTTGCGCCCACAGGTCGGGCTGGGCAGGGTGAGGCGAC
CGGGCTGACGCGCTTCGCGTTGTTCGTCACGGGCACGATGGCCGACGCGGACAACGACGTGGTGATGGACGGCATGGGCG
CCGAGCCAGAGGCGGAGGCGGTGGCGCCGGCCAGCGCAGCAGCAGCCACCAACGGACATGCGACAGCGGGCAGCCAGGAC
AAGAGCGACGTCAAGGACGCTGGTAATGGCGAGAGCAAAGCGGCAGCCGAGACGTCAGAAGAAAGTGCACTGGGCTATCC
GGTGGACTTCAAGCGGCGCGGACTGCTGCCAACGGGCTGCTGCTACGACGACCGGATGAAGCTGCATGCCAATGCGGACT
TTGGGCCAGGGCCTCACCACCCGGAAGACCCGGCGCGGATCTCGGAGATCATGGCGGCGTTCAAGAGGGCCGGGCTGGTG
TACATGGGCTCGGAGGCCGACCTGGTCAAGATCATGCGCGAAAGCCCGACCAAGTACATGTGGCGGATTGCGACGCGTGA
CGCGACCAAGGAGGAGATTCTGCTGGTGCACCACCCGCGGCACTTTTACTGGGTCAAGGAGCTGTCGGTGAAGCCGACGT
ACGAGCTGCGGGAGATGAGCAAGCTGATGGACGAGGGCCGCGACTCGCTGTACGTGGGCTCGATGACATATGAGGCCGCA
CTGCTGTCGGCAGGCGGAGCGATAGAGACGTGCAAGGCGGTGGTACGGGGCGACGTGAAGAACGCGTTTGCGGTGATCCG
GCCGCCAGGCCACCACGCGGAGTACAACCAGCCGATGGGGTTCTGCCTGTTCAACAACGTGCCGATCTCGGTGCGGGTGT
GCCAGAAGGAGTATCCGGACGTGTGCCGCAAGGTGTTGATCCTGGACTGGGACGTGCACCACGGCAACGGGATCCAAAAC
ACGTTCTACGAGGATGCGAACGTGCTGTACATCTCGCTGCACGTCTTTCTGGACGGACAATTCTACCCGGGGACGCCGAC
GAACCCGTCGACGCCGGACGGCAACATCGACAAGTGCGGCGCGGACGCAGGGCTGGGCCGCAACGTGAACATTGGGTGGG
ACAACCAGGGTATGGGCGACGCGGAGTACATGGCGGCATTCCAGAAGATTGTGATGCCGATTGCGAGCGAGTTTAACCCG
GACCTAGCGATCATTTCGGCGGGCTTTGATGCGGCAGCGGGCGACGAGCTGGGCGGCTGCTTTGTGACGCCGGCATGCTA
CGCCCACATGACGCACATGATGATGTCGCTGGCGGGCGGCAAGCTGGCCGTCTGTCTGGAGGGTGGCTATAACCTTCAGG
CGATCTCGGCGTCGGCGCTGGCGGTAGCGCGAACGTTGATGGGCGAGCCGCCACCCAAGTTCGAGGTGCCGAAGCTGGGA
AAGGCGGCGGCGCGACTGCTGGCACGGGTGCAGGCTCACCAGGCGCCATACTGGGAGTGCATGCGGCCGGGCGTGGTGGA
CGTGGCCGATCTGCAGGCGCACGGGGGGGTGCGGCTGCACGACGTCGTCCGGGCGTACCAGCGGCAGCAGCTGTCGGCGC
AGCACGGCATGTTCCCGCTGTTTGTGCAGCGCAGCACGATCTACAAGACGTATGAGGACCAGGTGCTGGTGACGCGTAGC
CTGCATGCGGCGCGGCGGATTATGGTGATCATGCACGATCCGTGAGTGAAGTGGGTGGAGAAGTACTGGCAGTGCAGGAT
TGTGCTGATCTGAACAGGCCGGAACTTGTGGGCCAGCCAGACGTGCTGGACAACTCGCTGGACGCACACAATGCGTGGAT
GGTATGGCCCCCTAGCACGGTTTTGTCCGCCAGCTTCACTAACACGGTCAGAGCGACGGGGTGATGCCGCACATCGAGTG
GGCCATCGGCCAGGGCTTTGGGATCATCGACATCAACGTACCACACTACCACACACAGCCGGAGGACACGGAGTCGCACG
TACCTCGCATGACGGAGGAGGCCATGCAGGGCCAGCTGCAGGAGCTGGTGTGCTACATCTGGGACAACTATCTACAGATT
GCGGACGCGGCTCAGCAGATTGTGATTGTGGGCGTGGGCCAGGCTTATCTGGGAGTGAAGATGCTGCTTGTGAACAGAGG
TTTGTTTGTTGTTTGTTGTTTGTTGTTTACTCGTTTGTTATATTGATTTGCCACTAACATGCCAGACTGCAAATCCCGCA
TCACCGGGGTGGTCAACTTTGTCAGCGGCAGCCTGCGGGCGGTCAAGAGCGATGCGGATCCGGACCTGACGCAGTGGTAC
AAGACGCACTCACGGGTGTACGTGGGCAACGACCATGCGTGCTGGCAGACCAACGAGTTCATCCGCAAGATCAACAAGCG
GCGATTCGGCGACGTGGTGCGCAGTCCGTTCACGGGCCTGAACCGCATGCTGCGCGAGCACGCGGCCGATGCACACGAGT
GGATCACGGAGCGGTTGCCCGAAGAGCATGGAAATACGACAGAGGACGACAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62