GenePrediction:GLEAN_2012 Details

Name: GLEAN_2012
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:109235..111687 (+ strand)
Length: 2453
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:109235..109263 (+ strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_108:109326..110106 (+ strand)
Length: 781
Type: CDS
Source: GLEAN
Position: GCSC_108:110353..110749 (+ strand)
Length: 397
Type: CDS
Source: GLEAN
Position: GCSC_108:110999..111687 (+ strand)
Length: 689
>GLEAN_2012 class=GenePrediction position=GCSC_108:109235..111687 (+ strand)
ATGGACCGAGACCGGGGCAACACCCGTCGGTGCGTGTGGTGGCGAGAGCGAGAAGCACGGGCTGAGCTAACCAAACGATG
CTGGGCTGCAGATACGATGACGGCGAAGTGACTCGATACGGGGCGGGCGAGTCATGGCGACCGACAGCCCGGGGCGACAG
GTCGCCGCGACGGGAGAGAAGTCCACCGATACGAGAGCGCGAGCGGATGCGAGACTGGGGCAGCCGAGAGAGAGACCGGG
AATGGGACAGGGGTCGAGACCGGGAGCGAGAGCGAGAGAGGGAGCGGGAGAGGGAGCGAGAGCGAGAACAGCGAGAGCGA
GAGCGAGAACGGGACCGGGATAGGGACAGGGACCGAGACCGGGACCGGGATCGCGACCGAGATCGAGATCGAGACCGAGA
CCGAGACCGAGACCGGGACCGAGATCGTGACCGCCGGCCATCGCCTCCACCGGCCAGCGACAGCTATGTTCCGGGCGGCC
GGGAAATGGCAGGGCCGCCACGACGTCCGCGGTCGCGCAGCATCGACCGCTATCGGACGGCGCGCGGTCTCGAGGACCGG
CCGCGCGAAGCGGTGGTGGGAGCTGGAGGCATCGGAGGCGAGCGATGGCGACCGGCACCACCTCCACTTCCGATGCTGGA
GCGCAGCCACAGCCGGGTACGCAGTCCTGGCGGCGGCGGCCCACCGTCGATTAACGGCGCCGTCGCGACGCGGCCCCCGC
TACAGGGCACGAATATCAACATGGCGTCGCCGCGCCGCAGCCCGCCCCGACGGCCTTCGCCGGCACAACGCTGGGGTGGT
GGCGGCGGCGACGACCGGGACCGCGGGGGCCGGTCGCCGCGACGGGACCTGACGATGCGAGATATGCGGGATGTGAGGGA
TGTGCGAGACCTGAGAGATATGAGAGATATGAGGGATATGAGGGACATGAGAGACATGAGAGACATGAGAGACATGAGGT
AAGAGAGAAGAGAGAGAGGAGAGAGAAAAGAGAGAGGAGAAGAGACACAAACAAATGCTGACATAAGCAGACGACGATCC
CGGACACCTGATCGTGATCGTGGTGGCTTGCCATCACGGAACCGCTCTGTCGGTTCACGTCGCTCGCCCCCGATGCAGCG
CTACAGGGCACGATCAAGGAGTCCCGACCGGCCGCCAGACGATTATCGCGGTGGCGGTGGCTACGGACGGAGGCCGTCGC
CACGACCATCGGCATCACGGCCCATGTCGCCGCGACCCAGCCCCGGTCCAGGCGGCTGGAACGATGTCCGATCGCGCCAG
CCATCGTCGGCACCACGATCTCCGCCTCTGGCAGCATCATCATCGTCCATGCGGTCGCCTCCGCACGGTCCGGCTGCACA
GCGAGGAGGAGGAGGAGGAGGACAACCGCTGACGGCGACCCCGTCTGCTCGCAAGATGGCCCCAATCGGAGCTGGAGTGG
CATCGGTGCCGTCATCCATGCCGTCAACGCCACTGGCAGCCCCGCGAGGACCGTTTGCCTACGGCGGTGGTGGCCGTGAG
GATGCCTCTCCCTCTCTGACGGCAACGCCGACAACGACGACGACGACAGCGACAGCAGCAGCAGCAGCAGCTATAGTGGC
AGCAGCAGCAGGCCTGCCACCGCCGTCGGGTCCGCGCGGCTACGGTGCCATGCGCAGCAACAGCATCAGCAACGTGAACC
TGAACGAGCGTGGCAGCAGCAGCAGCGGCAACACCAACGGAGCTCCCTTCACGCCACGAAGCGGCCGCAACAGCATCCCG
ACAGGGCCACGCGGTGCATCCATCAGCGGGCCTTCTGGTGGTGGTGGCAGCAGCATGGCATCCGGCGGGCCATCAGCATC
AGCAGCAGCCGCAGCTGCAGTGTCTGTCAACATGAGCCGAGGTGGATCGCCGGCCATGGGATCGCCGGCTGTCAGCCTGT
CTTCAGGAGCAGCAGCAGCAGCAGCAGCCGCTGGCGGACGACTGTTCAACCCGCCAACCGGACCGGCAGCACAGGTTGGC
AGTGGCAGTGGCAGTGGCAGTGGCAATGGCAATGGAACCGGACCGAGTTTGGGTCTGGGCAGCGCCACCAACAACAGCAC
TGGTATCGGCTCTGGTGGATCGTCCTCTCTTTCTGGTTCTGGTTCTGGTTCCGGTTCCGGTTCCGGCTCGCTCGCCCAGC
AGATGCTCGCCGGCATGCCGACGCTGGTAGCCGGCGGACGGCTCGACGGCCAGCTTGCTCTGCCCCGTGGCGGTGGCGTC
GTCCGCGAACTCGAAGCCCATCACCGCCGTCTGCGCGAGGAAGAAGAACGGCTGCGCCAGGAACTCGAGACCCGCCAGGA
ACGGCTCCGTCGGCAGCTGCGCTCGTGGGACCGCATGGATCGCGACGGCCGCTCCTTTGAGCTCAAGAGCAACCTCAGCG
AAAAGAGTCTCAAGACCATCGCCGGCGAAGGCGTCGGCGGAGCGGCTTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62