GenePrediction:GLEAN_2013 Details

Name: GLEAN_2013
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:115859..116808 (+ strand)
Length: 950
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:115859..116118 (+ strand)
Length: 260
Type: CDS
Source: GLEAN
Position: GCSC_108:116175..116808 (+ strand)
Length: 634
>GLEAN_2013 class=GenePrediction position=GCSC_108:115859..116808 (+ strand)
ATGTCTCACTTGCATTCCCACGACGGCGGCATCACCATGCACGCCAGCCACGGCCATGATGCCGGCAGCTTCATGCACTC
CCACGACGGTGGCATCACCATGCACGCCAGCCATGGCCACGAGGCCAGCAGCTTCTCGGCCGTGGAGCATGGCCACAGCC
ACGAGATCCTCGATGGGCCGGGCAGCTTCTTGGCCCGTGAGATGCCCATCATCGACGGCCGCAACTGGGAGGAGCGCGCG
TTTACCATTGGCATTGGCGGGTATGTTCTGTGGTTTGTCCTCTCACCACGCACAATTCAAACTGACAGCCTCCCAGTCCT
GTCGGTTCGGGCAAGACTGCCCTCATGCTGGCTCTCTGCCTCGCTCTGCGCGACCGCTTTTCGATTGCGGCCGTCACCAA
CGACATCTTCACGCGCGAGGACGCCGAGTTTCTCACCCGCAACAAGGCCTTGCCAGCCGACCGCATTACGGCCATCGAGA
CGGGCGGATGTCCTCACGCGGCCGTCCGCGAGGATATCAGCACCAATCTGGCCGCCCTCGAGGACATGCAGGCTGCCTTC
CACACTGACCTGCTGCTCATCGAGTCCGGCGGCGACAACCTGGCGGCCAACTACAGCCGTGAGCTCGCCGACTTCATCGT
CTATGTCATCGATGTCAGCGGTGGCGACAAGATCCCCCGCAAAGGCGGTCCCGGCATCACCCAGAGCGACCTGCTCGTCG
TCAACAAGACCGACCTGGCCGAGGCCGTTGGCGCCGACTTGGGCGTCATGGAGCGCGACGCCCGCAAAATGCGCGAGGGC
GGGCCCACCGTCTTCGCCCAGGTCAAGAAGAACGTCGGCGTCGAGCATATCGTCACGCTGATCCTCAGCGCCTGGCGTGC
CAGCGGTGCCGAGTCGGTCGTCAAGAAACAGGGTGGACCGCGTCCGACCGAGGGTCTCGACACTCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62