GenePrediction:GLEAN_2014 Details

Name: GLEAN_2014
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:119815..121581 (+ strand)
Length: 1767
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:119815..120564 (+ strand)
Length: 750
Type: CDS
Source: GLEAN
Position: GCSC_108:120616..121581 (+ strand)
Length: 966
>GLEAN_2014 class=GenePrediction position=GCSC_108:119815..121581 (+ strand)
ATGATGGAAGTCGCAACGACAACGACGCATGACCGTCCGAGAAAGAAGCGGACGGGCGGAGCTGGGTCTGCTGCCAGATC
TGGTGCAGGCACAATGGTAAAACACAACAACGGAGCGAAAAAGGTGGACGATCTACGGCTATCGCTACGGCCAAAAGAAG
AGCAGGAACGGATACGGAGGCACAAAGAAGCGCAGAGCCAATATGGGCGCGGCAAGCAGATACCCCTGAAGGCGGTGCAG
GACAGGAAGCTGAAGAGAACTCTCGGAAACCTCGAAAGCCGCTACAAGAGGGCGGTCGACCAGGCCAAGGATGCCGAGGT
GCTCTTGGAAAACGCCAGCGGCTTTCTCGAGGCCGAGACCGATCTGGAGCGCACGTACAAGGTGCGGCAGGATGAGATTG
TCAAAGAGGCACCGATTGCGGTAGCGCAGAAACGCTTCGATCTCAAGCTTGATCAGCTGGGGCCGTACATGTGCGAGTTC
ACGCGGACAGGTCGCGAGCTGCTGTTGGCCGGCCGCAAGGGACACGTCGCCACGATGGACTGGCGTGAGGGAAAGCTGGG
ATGCGAGCTGCAGCTGGGTGAGACCATCCGCGACATTCGGTGGCTGCACAACAATCAATACTTTGCTGTGGCGCAGAAGA
AGCACGTGTACATCTACGACCGGAACGGCGTAGAGCTGCACTGCATGCGGAAGCATATTGAGGTCTCCCACATGGAGTTT
CTGCCATACCACTTTCTGCTGTCAACCATTGTAAGTCAGCCCCTCTCCCTCTCGTCGCAATCGGACGTCTAACCCGTCCA
GAGCCTGTCCGGCCAGCTGAAATACCAAGACGTGACAACCGGCAACCTCGTGTCAGAAATTCATACCAAGACAGGGGCGC
CCTGCTCGTTTACGCAGAACCCGTACAACGCGGTCGTGCATGCGGGACACCAGAACGGCACGGTGACGCTGTGGTCGCCC
AACTCGTCGGAGCCGCTGGTGAAGCTACTGGCTCACAGAGGCCCCGTGCGGGCATTGGGCGTCGACCGGCAGGGCCGCTA
CATGGTGTCGGGCGGCCAGGACTGCCGGATGTCCGTGTGGGACATTCGCATGTTCAAGGGCGAGGTCGGCAACTACCACA
CGCACCACCCGGTATCGTCGATCTCGATCTCGGACTCGGGCGTGGTGGCCACGGGCCATGCCACGCGCACGACGCTGTGG
AAGGGTATCTTGACGGGCCCGGTGGAGGAGAAGCCGCTGCCGTACATGAAATGGGGTGGTGATGGCAAGGCGATTGAGCG
GGTGCGGTTCTGTCCGTTCGAGGATGTGCTGGGCGTCAGCCACAACATGGGCTTCTCGTCGCTCATCGTGCCGGGTGCGG
GCGAGGCCAACTTTGACGCGCTCGAGGTGAACCCGTACGAGACGGTGAAGCAGCGGCAGGAGGGCGAGGTCAAGGCGCTG
CTGAACAAGCTGCAGCCGGAGATGATCGCGCTGGACCCCAACTTTGTCGGCAAGCTGGACGAGCGGTCAGAGGCGCAGCG
ACAGGCAGACCGCGACCTGGACGCCGTGCCGGTGGACATTGGGGACGAGATCCGCAACAAGATGCGCGGCAAGAACACGG
CGCTCAAGAAGTACATACGGAAGCAGCGGAAGAAGAACATTATCGACGAGAAGCGTCTCAAGGTGGACGAGATCTGGAAG
GAGCAGCAGAAGCGGAAAAGGGAGAAGCTCGAGGAGGCCAAGGAGGATCTGGGGCCGGCGCTGGGCCGGTTTGCACGGAA
AGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62