GenePrediction:GLEAN_2018 Details

Name: GLEAN_2018
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:155316..156506 (+ strand)
Length: 1191
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:155316..155336 (+ strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_108:155521..155533 (+ strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_108:155768..156157 (+ strand)
Length: 390
Type: CDS
Source: GLEAN
Position: GCSC_108:156230..156310 (+ strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_108:156376..156506 (+ strand)
Length: 131
>GLEAN_2018 class=GenePrediction position=GCSC_108:155316..156506 (+ strand)
ATGGCCAACGACGAGTACGATGTGAGCAGATCCCTCCCTTTCCTCCCGGATTGCCCCTCTCTTCCACCGCCCTTCTGCTG
TCTTGTGTCTTGGCCACGAGCTTCAAACCGCTGCCACATCGCCGCAACTGGACCTCCGGATCGCCGTGATGCATCTTATT
CTCTCCTAGAAGAAGCGCTTTTGCTGACTATGCTTCTCATAAAAGTTTCTCTTCAAAGGTGAGAACGCACCACCGCTGCT
ACCTCTGCGACCGAGCTGCCCACTCTTCCAAGTTCTATCTGTGACAGCCTTGGTAGGCGGATGGAAGATCGGACTAGCTG
AGGATGGACAGGTTGCAATACGAAAGAGGCGGTTGCAGTCGCCATTACCGCCGTTGCTACCAGCATCGCCGTTGCTGACA
CATGGCCGGTTGCCCACGCTGTTCTTGTGCTAATGTCGCTCTCATTCCTTAGTCGTCCTGATTGGAGACTCAGGTGTCGG
AAAGTCCAACCTGCTCAGCCGGTTCACGCGTAACGAGTTCAACCTCGATTCCAAGTCCACCATCGGTGTCGAGTTTGCCA
CGCGGTCCATCCAGGTCGACTCCAAGACCATCAAGGCACAGATCTGGGATACTGCTGGTCAGGAGCGGTACCGCGCCATC
ACCTCGGCATACTACCGCGGCGCTGTCGGTGCCCTACTCGTCTATGACATCAGCAAGCACCAGACCTACGAGAACGTCAC
CCGGTGGCTAAAGGAACTACGCGACCATGCTGACGCGAACATCGTAATCATGCTGGTGGGAAACAAGAGCGATCTGCGGC
ACCTGCGGGCCGTACCCACAGAGGAGGCCAAGGCTTTTGCAAGTACGTATACGTCTGCCTACTGACAAAGGGGCGCCTGC
GGCTTTTGTCATTCTAACCTGTCTTTGTCACTAGGTGAAAACCACCTCTCCTTCATCGAGACTTCGGCCCTTGACGCCAG
TAACGTCGAGCTTGCCTTCCAAAACATCCTGACAGGTAGGTTCCATCTCAATTGAGGCGGTGAGGCCATAGGGACATGTT
ACTAAAGCAGTTTCCGACAGAGATCTACCGCATTGTGTCAAGCAAGGCTCTCGACAGCGGCGACGGCGCCCAGGCTACGA
TTGGTGCAGGCACAAACATTTCACTCAGCAAGCCGGCCGAGGACGCGACGGCAAAGAGTGGGTGCTGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62