GenePrediction:GLEAN_2019 Details

Name: GLEAN_2019
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:157685..158215 (+ strand)
Length: 531
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:157685..157774 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_108:157879..158096 (+ strand)
Length: 218
Type: CDS
Source: GLEAN
Position: GCSC_108:158164..158215 (+ strand)
Length: 52
>GLEAN_2019 class=GenePrediction position=GCSC_108:157685..158215 (+ strand)
ATGCGCTCCAAGTTCAAGGACGAGCATCCGTTTGAGAAGCGCAAGGCCGAGGCCGAGCGCATCCGCCAGAAGTACGCGGA
CCGGATTCCGGTACGTTTCTCCTTTTCCTTCCTCCCTCTTGCCTCCACGCTTCTGTTCTTTTCCGTTTGGCGCAACGTTG
TTAGGAGAACGCGTCGCTGACTCAAGCCCCACAGGTCATTTGCGAGAAGATCGAGAAGAGCGAGATCGCAACCATCGACA
AGAAGAAGTACTTGGTACCGGCCGACCTGACCGTGGGCCAGTTTGTCTACGTGATTCGCAAGCGCATCAAGTTGGCGCCC
GAGAAGGCCATTTTTATCTTTGTCGACGAGACGCTGCCGCCTACAGCGGCGCTGATGTCAAGCATCTACGAAGAGCACAA
GGACGAGGACGGGTACGAAACCCACGAACCCCCTTTTTAAGTTGCGTTTTACTGTATGATGCTAACCTTGTCTTCACAGC
TTCCTCTACATCCAGTACTCGGGCGAGAACACGTTCGGCGTCGACGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62