GenePrediction:GLEAN_201 Details

Name: GLEAN_201
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:192199..193390 (+ strand)
Length: 1192
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:192199..192901 (+ strand)
Length: 703
Type: CDS
Source: GLEAN
Position: GCSC_167:192981..193390 (+ strand)
Length: 410
>GLEAN_201 class=GenePrediction position=GCSC_167:192199..193390 (+ strand)
ATGAGCATGCTGCAACGCCAAGTCTGCCGTCAGCAGCCGTTCGCAGCCAGACGTCTGGGGCTGTCGCTGGTGACTGCAAC
ACGGGCGCACTTTCGCACATCTTCAGCGGCGAGACAATCTACACTAATGACAAGGCTGGCTCCTCTCCAGCTTACATATC
GCACCTTGAGCAGCCCATCAACGCTACTGAACTCCGCTTCCTTCGCTTCTGCGGCTGGTGTGACCAAGGAGCCGAGCATA
CACAACGTCTTTGAGCCAGTCACAGGAACGTGGCAGTACGTAGTGGCTGATCCGGCTACATTGCAAGCCGTCATCATGGA
CCCGGTCTTGGACTATGACCCAGTCAGCCAGGCCGTCACTACTGAAGCAGCCGACGCTCTGCTGGCTTTCGTCCGGGAGA
AAAGCTACCAGATCTGTCATATCCTGGAAACGCATGCCCACGCCGACCATCTGACCGCTGCATCCTATCTCCAGAGCCGT
CTGGCAGAGAAGCAAGGACACAAGCCACGAATTGGTATAGGCAAACGCATCACCCAAGTGCAGACTCTGTTTGGCAAGCG
CTATGGCGTTCCTGCAGAGGAGTACGGGGCTGTCTTTGATACGCTCTTTGAGGACGACGAGACGTTTGCTATTGGAAACC
TGCAAGCGAAAGCTGTCCATCTGCCTGGCCACACGCCGGATCATGTTGGATATATGATTGGAGGTAGGTATTTCGTTTAA
ATATGTATTGAATAACTCGTCGCATTATACTGTGTCTAATCTGACATTGCTCTGGCCAACAGACAACGTTTTCTGTGGCG
ATTTGTTATTTCACGCAGATATTGGCACTGCTCGATGTGACTTTCCCGGAGGAAATCCTAGTCAGCTTTTCCACTCGGGA
CGCAAGCTTCTCGCTCTGCCTGGACATGTAAAGATCTGGACAGGACACGACTACCCACCCGAGGACCGTCGAGACGCCGT
GGCATGCTTGACCGTGGACGAGCACAAAGCGCAAAACAAGCATCTCTCTGGTGGTGTCACTGAGGAGGTGTATGTGACCT
TGCGTCGGGCAAAGGACGAGACAATGGCAGCCCCAAGGCTCCTTCACCAGTCGCTTCAGGTCAACATTCGTGGAGGTCGG
CTGCCGAAGCCGACGTCAGAAGGCTTGCGGTTGTTGCATCTTCCTTTGAAACCAAACGGGACGGAGTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62