GenePrediction:GLEAN_2020 Details

Name: GLEAN_2020
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:159410..161648 (+ strand)
Length: 2239
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:159410..159631 (+ strand)
Length: 222
Type: CDS
Source: GLEAN
Position: GCSC_108:159690..160835 (+ strand)
Length: 1146
Type: CDS
Source: GLEAN
Position: GCSC_108:160986..161648 (+ strand)
Length: 663
>GLEAN_2020 class=GenePrediction position=GCSC_108:159410..161648 (+ strand)
ATGGCTGCGTCGGGACGGATGCTGCGTCTGCTTGCGCAAAGCAGACGGAGAGTGACAGGGACAATTGGCACGAGAGGAAC
CGGAGCAGGCACAATTACGACAGCCCGGAGAACAATTGCTTCGAGCCGTGTCAGTGCGCCACAGTCTGCCATTAACGGTT
CAGCAGCAGCGGCCGCGGCCATTGGAGTTGCTGCGGGCAGCTCATTGCTCTTCTACAACATGGTGAGGCTCTTCTGGCGA
TCGGTCTTGGTTGCGAGCGGCAAATGCTGACGGGCTCTAGGCTTCACAAGATCCAATTCGATGTGACTCGCCGTCGCTAG
CAGAGCGGGACGAGCAAATTCGGCGAGACACGGGCGGCGTGGTGACGGAGCAGTCGCCGATGCGGCTGCGAATGGAGAAG
TTCATCAAGGAGCAGCAGCAGGTGATCATCCGGGGGCTGGCGGAGATTGAGAACAGCGGCGGCGTGGCCAGCGTGGGCGG
ACCGGTGGAGGGTCGTTCGGCAGACGGACAGACGGCGCCACGGAGTTTCCGACAGGACGAATGGCAGCGCAAGGAAGGCG
GCGGAGGGATCACGTGTGTGCTGCAAGACGGGGTGGTGTTTGAGAAGGCGGGCGTGGGTGTCAGCGTGGTGTATGGCACG
CTGCCCAAGGCAGGCATCATGCGGATGCGGGCAAACCACAGCAAGCTAGGCGGCAGCAGCAGCGGCAGCAACGGTGAGGG
GCTGCCAGAGTCGCTCGAGTTTTTTGCGGCCGGTCTGAGTTTGGTGGTGCATCCACGCAACCCGATGGCGCCGACGGTGC
ATCTCAACTACCGGTACTTTGAGACGGCAGCACCGGGCGGCGGCGAGACCGGCGAGTCGGACGGCGGGGCGTGGTGGTTT
GGCGGAGGGGCCGACCTGACGCCATCCTACCTCTTTGACGAGGACGCGATCCACTTCCACAAGACGCTCAAGGAGGCGTG
CGACCGTCACAACAAGGACTACTGGCCGCGCTTCAAGCCGTGGTGCGACGAGTACTTCCGCAACAAGCATCGGCTCGAGA
GCCGCGGCGTTGGCGGCATCTTCTTTGACGACCTCGACGAAGAGAACGCCAACAGCTGTGGGGCTGATCGCGAGAGCCTC
TTTTCCTTTGTGCAGGACGGCCTGCGATCCTTCTTGCCGTCATATGCGCCCATCATGGCACGCCGCAAGGACATGGCCTT
TACCGAGGCCGAGAAGGAGTGGCAGCAGATCCGCCGCGGCCGCTATGTCGAGTTCAACCTTGTCCACGACCGCGGCACCT
CGTTTGGGCTCAATACGCCCGGGCCGCGCGTCGAGAGCATCCTGATGAGCCTGCCGCTGACCGCCAGCTGGAAGTACATG
TTCGAGCCCGAGCCCGACAGCCGTGAGCAGCATCTCGTCGACGTGCTGCGGAAGCCGCGTGAATGGGTGTAGGATAGTGT
TTGAGAGATAGCACGTAAAAAAAAGGGGTGTCGAGCGTGGAGGGTTGGATTGGTAGATTTGCACCAAAAAAAAAAGAAAA
GAGAACCCCGAATTTGAAGTCGATGACATAATATCCCCAAACAACCATAAACACAGACGCCATCGGCCACGGTCCCAACG
CCTCATGTGCTGACCATGGCCTCCTCTCGCGGCCTGCTGCCATCGCCGCAGCGTCTCCTTGTCGACCTGGTGCGGTCCAT
TGGCGCGATTGCGGTGGACAACGACGATGGCGATGACGTCGGAAGAAGGGAGCCGTCTGCGGATGGCAATCCCCTCGCCC
GCATGCCCGCTAGCCAGCGGCCCTTGCTCGCGGCCCTGCACGTCCTCTTCCCAGCCATGCTGCTGCCGGCCCTGGACCTG
CTGGACCGGCGGCGGGTGGTGCGGTACGGCTCAACAGCCACGACAGACTCGACAGGCGAGGCCGCCTTTCCGCTCTACCA
GGTCTTGGGCGACACGCCGCACGTCGTCCACCTGCGTGCTTGGCACTGCACATGTGCATACTTTGCGCTGCGAGCAGCCG
GCGCAGAGACCACCAGAAACACCGACGGCGAGCATGGCCGGAACAGCCCGGCAGACCAGAATGACCAGGACACCGATACC
GTCGACGACAACAACCTCACCCTCTTCTCCATCCCACCCTGCAGACACCTGCTGGCCTGTCTCCTGGCCGAGAAATGGCC
GGCACTGCGGCCCCATGTCCTCGCCATCGACGGCTGCGGCCCCGAGGTGCTGGCTGGCGTCGCTGCCGGCGTCCACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62