GenePrediction:GLEAN_2021 Details

Name: GLEAN_2021
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:164511..165571 (+ strand)
Length: 1061
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:164511..164661 (+ strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_108:164736..164788 (+ strand)
Length: 53
Type: CDS
Source: GLEAN
Position: GCSC_108:164872..165026 (+ strand)
Length: 155
Type: CDS
Source: GLEAN
Position: GCSC_108:165106..165571 (+ strand)
Length: 466
>GLEAN_2021 class=GenePrediction position=GCSC_108:164511..165571 (+ strand)
ATGGGTGCCATTGAGGAACAAGTGAAGCGTTTGAACGATGTCGTGGCCAGCCTCGAGGACCGTATCAAGGGCCTCGAGCA
GCGCAAGTTCGGCGAGGTGGCGGCGCCCAAGAAGGATATTCGCATGATTCTTATCGGCCCCCCCGGTGCTGGTATGTAAC
TGCTTCGGAACTTGACCGCTGCCGGATGCGATTGGAGCTGACGCTGACGTGGAATGCGACCATAGGCAAGGGCACTCAGG
CACCGAAGATCAAGGAGAAGTTTGGCTGCTGCCACCTGGTACGTCCCCCCATGACGCCAATTCGTACTATCTTGTGACTG
TAGCTTTGTGTGCTCATCTGCTAACGATTGTCGATATTCAGGCCACCGGTGATATGCTGCGCTCGCAGGTCGCGAAGAAG
ACGCCGCTTGGCCGGGAGGCTAAGAAGATCATGGACCAGGGTGGCCTTGTCAGCGACGACATTGTCATTGGCATGATCAA
GGAGGAGCTAAACACAAACCCGGAGTGCAAGGGCGGGTGAGTTCTGCCTTGCTATCTTCGGCTCTTGCTTTTTTGCCCTC
ATACTCACTTTAGTTCAATTTGCTGACGGCTCTAGCTTCATTCTGGACGGCTTCCCGCGCACCGTTCCCCAGGCTGAGGG
CCTCGACAGCATGCTCAAGGAGCGCAACCAGACGCTGCAACACGCCGTCGAGCTGCAGATCGACGACTCGCTGCTGGTCG
CCCGCATCACCGGCCGCCTCGTCCACCCGGCGTCTGGCCGCAGCTACCACAAGCTGTTTAACCCGCCCAAGAAGGAGATG
ACTGACGATATCACCGGTGAGCCGCTGGTCCAGCGCTCCGACGACAACGCCGACGCCCTCAAGAAGCGCCTGTCCACCTA
CCACGTGCAGACGGCCCCCGTTGTTGATTACTACCGCAAGACGGGCATTTGGAGCGCCATCGACGCCTCGCAGAAGCCGG
GCCAGGTGTGGAGCACTCTGCTCAAGATCTTCGACGGCGATGCCAAGAAGGCCAGCTCGTCGGGCAGCGGCATCCTCAGC
AAGCTGAGTGCCAGCAGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62