GenePrediction:GLEAN_2023 Details

Name: GLEAN_2023
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:170430..172142 (+ strand)
Length: 1713
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:170430..170438 (+ strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_108:170515..170764 (+ strand)
Length: 250
Type: CDS
Source: GLEAN
Position: GCSC_108:171040..171525 (+ strand)
Length: 486
Type: CDS
Source: GLEAN
Position: GCSC_108:171580..172142 (+ strand)
Length: 563
>GLEAN_2023 class=GenePrediction position=GCSC_108:170430..172142 (+ strand)
ATGCCTCGAGTGAGTGATGACTTCACTGCTTCCTCAGCTTCAGTCCGAAGTCTTTTCTCACGCAGTCACTACTCCCCCCT
TGCAGAACCACCGCTCCAGACGTAGAGGCCCCCGGGCTCCTCCCCCTGCGGTGCCTCAACGCAGCTTCCCCAAAGAGTAT
GAGGACTATCTCAGAGGCGTTGATGCAGCTACCGAAGCTCTGAAGTCAAAGAACATCGAGACAAACATCGAATCAAGCTT
CGATGACGCAAAGGTCGATACCGCCACGGTCATCGAAGCTCCCATGACCGAAGCCCTTGACAAGGGAAAGGGGAAGGAGA
CTTGCATCGATTCAGGTACGTGAATGCAATCCCATCTACCTGCAGAGTGTCTTCCATCCGACATCTACAAACAAACACGT
CAAGATGCTGACTTTCCCGTTACCGGGAAAGCAGATGAGGTGTCGAAAGGAAACTACCTGTTCACTCGCGGAGAAGTTCC
CCAGGGAAAGACCCATCTGTTGACTCATGCTTCTGACACGCATACAAACATCTTTCCCAAAGGTATAAGCAGAGCACCCC
GCCATCATCCATTAAGTTTCCATGCTGACTATTGACCTGTCTATTAACAGAGTTTATGACGAAAGTCGGGCTTCCCAGCC
AGAATCGAATGGAGCCTCGCCAGGCCGGAAATAACCCAACAAAACAGGCCGCAGCTGGAAGCACTAGATATGATTCCATT
GCTGGCGAGTGTCACGAAGCTGGTCCAGCTACACTGTACTCGCCGGTTGCTGGTCCCTCCAAGTTTCCTTTCATTGGCAA
AACCCCCACTGGCCCCACTGCAGGATCTCTGCCGAGAACTCACATTGATCTCACCTGGGGTCAACAGAAGACTTCTCCGG
TCCCAGGTGTCTACGGTGCGAAGACGGCAGGTCATCAGGCTAAGCGTCCGGTCCTCGGATCTTTCCAGAAGCCAACGCAG
CTGAGCGCAGATTCTCCCTCGTTTCATCCACAGGGAGCTACGCCTGCTGCTCTGATAGATGTTGCCAACAAGGGTGACCG
GCTGCTGCAGTCCATTGCATCATCGTCAACAGTTGCTATGTACACAGGTAACCATGGTAAGACCAGGCCCATCCCCGGCG
CTACATTAAGTCCTCTCTAACAGAATACAGGAGTGCTGCGGGCCAGAGATGAGCTGAATAGGACTGCTGCTTATTGCTCG
ATGCGCGAGAAGGCTGATTTTGCGGGCTGGGGCAAGTCCCCATTTCTTCCCCAATCGCCGATCGACTTCGTTGCGCACCA
GAGACAGATTGTGGCTGCAGAGATGAAGCGAAACATGAACCGTGTTGCGATGCTCGAAGCCACGCAAGGTAAACACAAGG
CCATGCTCACGCTTGACTTCCAGGACGGCCTGTCGCCCATGCTAGTGCAGAAGACAAGCTTCAATGATGTGGAGGCAGAC
TACCAGAAATATGTGACGGACTGGCCGACGCCGCACGAGCTGCAGATGTCTGGCACTTCTCTTCCACTCCCGCAGAAGAA
GCAGGCGGAGTCCGGAGAGCAAGCGCAGCGCACCACGTTCTGCACCCAGGAAGACGAGACTCGCACATGGGACTGGCTCA
GCCCGTTTCAAGCTGCCTCCGTCCGAGCTGAGGATCCTGCCACGATTGACGAGGACACCCTCGGTTCTTGGATGCGTGAC
CTGATGAAGGCAATTGACCAGGACGATGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62