GenePrediction:GLEAN_2024 Details

Name: GLEAN_2024
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:172894..173655 (+ strand)
Length: 762
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:172894..172957 (+ strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_108:173105..173655 (+ strand)
Length: 551
>GLEAN_2024 class=GenePrediction position=GCSC_108:172894..173655 (+ strand)
ATGGGTATCTCCAGAGACTCTCGCCACAAGCGCGCGGCCACCGGTGCCAAGCGTGCCTACTACCGTGCGTCGATTCCCAC
CGAGTGAATACTGTTACTGCTGTTATCTTGTTTGGGTGGACGGGGGATCTTTCATTTTCGAAAGCCCGTATCGGACTGGG
AGAAGGCTTCTCTTTCTCATCCAGGACATACGTTCTGACCTTTGCCAACAGGGAAGAAGCGCGCTTTCGAGGCCGGGCGC
CAGCCCGCCAACACCCGTATCGGTGCCAAGCGTGTGCACGTTGTGCGCACGCGTGGCGGCAACCACAAGTACCGTGCTCT
GCGTCTTGAGGCGGGCAACTTCTCGTGGGCGTCGGAGGGCGTCACGCGCAAGACCCGTGTGATCGGCGTGGTGTACCACC
CGTCGAACAACGAGCTGGTCCGCACCAACACCCTGACGAAGTCGGCGGTGATCCAGATCGACGCGGCACCTTTCCGCCAG
TGGTACGAGGCGCACTTCGGCCAGGCTCTGGGCCGGCGGCGGCAGCAGAAGCAGGCCGGTGCCGCGGCCGAGGAGCCGGT
GAAGAAGAGCAACTCGGTCGAGAAGAAGCAGGCCGCTCGCTTCGCCGCCAGCGGCAAGGTCGACAGCGCGCTCGAGCGCC
AGTTCGAGGCCGGTCGCCTGTACGCGGTCGTGTCCAGCCGTCCGGGCCAGTCTGGCCGTGCCGACGGATACATTCTCGAG
GGCGAGGAGCTTGCGTTCTACCAGCGCAAGCTGCACCGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62