GenePrediction:GLEAN_2027 Details

Name: GLEAN_2027
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:197509..203217 (+ strand)
Length: 5709
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:197509..197741 (+ strand)
Length: 233
Type: CDS
Source: GLEAN
Position: GCSC_108:197818..198016 (+ strand)
Length: 199
Type: CDS
Source: GLEAN
Position: GCSC_108:198111..198154 (+ strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_108:198219..198427 (+ strand)
Length: 209
Type: CDS
Source: GLEAN
Position: GCSC_108:198496..198699 (+ strand)
Length: 204
Type: CDS
Source: GLEAN
Position: GCSC_108:198756..198991 (+ strand)
Length: 236
Type: CDS
Source: GLEAN
Position: GCSC_108:199063..199307 (+ strand)
Length: 245
Type: CDS
Source: GLEAN
Position: GCSC_108:199382..199423 (+ strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_108:199555..199610 (+ strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_108:199672..200101 (+ strand)
Length: 430
Type: CDS
Source: GLEAN
Position: GCSC_108:200305..200533 (+ strand)
Length: 229
Type: CDS
Source: GLEAN
Position: GCSC_108:200603..200959 (+ strand)
Length: 357
Type: CDS
Source: GLEAN
Position: GCSC_108:202591..203139 (+ strand)
Length: 549
Type: CDS
Source: GLEAN
Position: GCSC_108:203188..203217 (+ strand)
Length: 30
>GLEAN_2027 class=GenePrediction position=GCSC_108:197509..203217 (+ strand)
ATGGACAGCACCGTCCCAGCCTCTGTGTTCGATGACCTCGCCAACCTTAAGGCGGCCAAGCCCGATCTCAAGATCTTCGT
CAGTATCGGTGGTTGGACCTTTTCCGACAACGGTACGACAACTCAGCCTGTCTTTGGCAACATTGCTAAGAGCGCTGCAA
ACCGCCAGACCTTCGCCGACAATGCATTAAGGTTCCTAAATAAGTATGGTTTTGACGGTGTGGACATAGATTGGTAAGGA
CCCTATATCGTTCCGTGTTTCGTTGTCTTCGCTTTTCGTTTTCCCTTTCTATGTTCTGACCAGTCTTAGGGAGTATCCTG
GCGCCCCTGATCGCGGTGGATCCAAAGAAGACACAGAAAACTATGTATCGATGCTAAAGACACTCCGGGAGACCTTTGAC
AACTCCGGTGCTAATCTCGACATTAAATTCACTGCGCCATCATCCTATTGGTATCTACAGTGGTTTGACGTACCCGGCCT
TCTCAAGTATGCAGACTGGGTGAACCTTGTACGTCTTTACCAGTGCACTATTATTTCTTTTCCCTCACCCAAACTTCAAA
AGCGCAAAAGCCCAAGCTGATAACATGAAATCGTTATGCTAGATGACATACGACCTTCATGGCGTGTGGGACAGTACAAA
TCCGATGTAAGAAATTGAATGGCCTCTGTTTGAGTGATGGCAACTGACAGGTTCTTTTTCTTTTGACAAGTGGCTCTATT
GTTCAAGCCCACACGAATTTGACTGAAATCAAACTGGCCGTCGAGTTACTATGGCGTGTGAACGTCAGGCCATCTCAAGT
TGTCATGGGCTTCGGCTTCTATGGCCGTGCCTTTACGCTGGCTGATTCTAGCTGCACCACTATAGGATGTCCGTTTAGTT
CTAGTGCAAAGCCTGGACCTTGCACGGCCACTAGCGGCTGTAAGTCTGAAAGAAGCGATATGAGTCTTTGTGCAGTGGGT
GTAATTGTAAATGTGCTCACAATACAGATTTGGCGTACTACGAGATCGAAGAAGTTCTGAAAAGCAACAGTGGCGTGGAT
GTGATCTGGGACAAGGATGCCGCCGCCAAGTACTTTACTTGGGATACAAACCAGTGGATCTCATACGAAGACTCGGACAC
GTTCAAGCAGAAGGTCGATTGGGCAAACGATGTGGGCATTGGCGGAGCTCTGATCTGGGCCTCCGATCTGGGTGTGTTGT
CTGTCCCCAAAAGCCCCGCTTGGAAGACGTCCGACTGACTCCTTCAGACAATTACGAGTGGACGGCACACAAGGCACTGA
CAGGCAGGACAAATCTCGGGTCTGAGCTGAGCATCAAGGTTTCTGCGCTGAGCACGTCCGTGCCTGCTGATCTCGACTCC
TTCTTTGCGCAAGACTGCTTTGTATTTCCCTTTAAGGTGGATCTGGACAACCCCCAGGCATCTAGTTGCGGGTCTGGATA
CACTAGAGTGGGATATGACAAGGCTGGATGCAAGGGAAAAGATGTGAGTAATTCGCTGCTCCTGTCGGCGATTCTGGATG
GGTTGAAAAGAACACTGAGCAACGTCATTTGTAGGGCATCTGCGGAAAGCCAATCTGCTGCAAGACTTCGTCGGCACCCA
AGGTATGCAAATGGCGCGGCTTTGGAGGCGACTGGAACGGCCAGTGCCATGCGGGTGAGGTCGAACTCGCGTCGTCCAGC
TGGGGCGGCATACCGGGCGAGTCTGGAACCGGGAAGTGCCGCCGTGGTAAGAAGGCGTTTTGCTGCGAGGTTGGCATCTT
CAATGCACTGAACTTGGGATGCTACTGGACATCAGGATGGTGAGTGCTTATCAATGAGCCGGATGATTGTCTTCGCTGGT
CCGCAATTTCCCCAGCGCTGACACAAGATGCAGCGACAAATCGTGTAAAGCCGACGAACAGAAGATTGCCCACATGTATG
ACAGCTCCAGATGGTCAACCGTGTTCTGTCATGGGAGCTCGTACTGCTGCCCGGGAATGCACCGGCACCATATACAGACT
GCCACTGGGTCGGCAAAAACGACTGCGCCCATAACACATGCGCCAGAACAGAGGTCACGCTGCGCACAAGTGACCGAGGA
GACAGCTTCGGTAGCTGCAACTGTACGCCATCCTCTCACCCATCTCGTTTTCTGGCGGCTAAAGCTGGTGTTGATTGATC
TAGGGAATCGAAAGAAGGCACTCTGCTGCACGCCAAACCTCGAAACTTTGACAACTATGACGTGCGATGCGGACCTTTGT
GCGGATGATTCTTGCGAAACTGACGAGCACGATTATGATGATTATCCAACGAGCGTCTTCGAACGAGCATATGATAACGG
CGGTATGTCATCGCTCCGTGTCCGCTCGTACGAGGCAGCCGACGGAAACACTTGGTTCAACTACGATGAGAGCATCGATT
TTAATCTGTTGGAAAAGCGTGGGCCCAAAGCTAGACCAGGACAGTCACGGAGTGGTTCATTCATCTTGAACGATATCTTG
AAAACAGGTTTTTATGGCGCGCAACTGGCTTGGGAGAGTAGGCCTTATCCCTCAGGCCTCAAAGTGCTCAAAGGCGACGG
ATCCTCTACACTTTCACTGCCAGGTGGTTATGGGTATGTTTTTCCTAGAACTTCTCCTCTTCCTAATTGTATATTGTACT
GCTTTTTGTCTTACGAAACAACCCAAAACAGACTACTGAAGGACACCTGCAGCGCCACTGCAGTATTATTTCAAGAAGCC
AAGGACCTCCCCAAAACTGGTTTCCATGCAGAACATTTACGAGAGGTATAACAACAGACTGCTAGTCCGGCTACAGATCT
AAACTAACTGGAGCGCAGGTTCAAATGATTCCGAGGTTCCTTCTTTCAACGCTTTTAGGCCAACTTCCAACTGGCGCTCC
AATGAAGACTAAGGTTAATATCCAGGCGCTAGTTCAAGGCTGGAACAAGGAATTTGACGTGTCCCTGCCGCGCATCGGCA
GCATTGTCACGGACGTCAAAAGCTGGACCAAGCCTTTGACGCCAAACGACCGCGTTTTCGAGGTGGTGAGTTTCGACGGC
ACTCGTGGAAATACCAGTGTAATATAACACAGGAAACTAATGCAAGGTTTGCAGATTGGATCCTATGCCTACCGCACGGG
CATGTCTGTACTACAGGGAAGCGTAAACCAAGTCAAGGGCAATCTCATGGGCCTGGAAAATCCAGTCGACCTCAAGCGGC
TCAGTGCAAACCTAGCTAAAATCGCGTCAGGCGCTCCGGAGGCCGAAAAATTGGCTGAACGCATCATGACGGCGCTGCAG
TCCACGCCGGCTGTATTCAATTACATAAACGACGCCGGCCTCCAACCCGCATGGCAGGCGTCGACAGACCTGTTGCACAA
GCAGCTGGTGTACACGAGTGAATACATTCCCGGGCTGGAAAACCTCTACGACGCGTGGCTTGAGTTTGAGCCGGACTACT
ACAATGCAGTTGTGAACCATTCTCGCACGTTTCTCATGCTTGCGATGCGCGAAATTAAAAATTATTACGCGAATGGCGGC
GATCTCAGCAACCCTTTGATCAACAGAATGTTGTTCCAGATAGCGGGGCTTACTAAGGCAGCGGCCCAGATTGAGCTTCC
TAATTTTGTCAAGAGCAACATAAAATGAGCAGGAAAGTGCGAAGAGGGAAGTGGCTTGGTTAGAGTACTGTGCTAACTAA
TCGGTATGTATATGCTTCGGCATTTACCGACCCTTATGAAATCATCCTACATATGTTGCCGAACAGACTAGGCCAGAGTG
AATGTAAAATGAGGTCTTGTGGCGCAGGATGTAAAGAGACAAGTACGGTAATGAACTGATTGCTTACTTAGCAGAACTGC
TGGTTGGATTGCTTATGCATATATCTAGAGAGGAGGGTGAAACTCTGCATAGGGTAAGTCCCTGAATAGCCAATCAGGGG
CCGCCACTATGTCACGTAACTATATGCTTACTTAACATACGGAGTATACTGTGGATTTCCCCGAGGTCACCTGACTTGAC
CTCGGCCGCCGAAATTACTAGATAAGACGAAGCCCTGATCTGCGCGCATACTGCGCACAGTCTGGTCTTCAATCAATGAG
TCCACCGAACGAAATATCATCACTAGATCTTCTGAAGGCCTTAGAGCTTACTACGATACGTGCAACTGGTCCGGACGAAT
ATCCCACAAGGATTACCGTACGGGTCTTACACTGGTGATCACGCAGAACCTGCGTGACAGACTAGTGGTGCACGGAGTAG
AAGCCACAATACTAAGCCCCACCTAATTAGTAGGGGATTTCATGCGCGTCGGCATATCTCGGGAGTATACTCCGTAGAGT
ACGGAGTACGGAGTAGCAACATATAACAAGATACCATGCTTACCGGGCGCCTATACTTTGATAATAGTGCGCATAGCAAA
GATCCATGGCGTGGTGAGCACTTCTTATGTGAAAGAGGGAAGTGTTCTAGTTGAGTATTAGGTGAAGCAGTCTGTATGCG
TGTATAGCCTATACTAGGTAAATGTATCTTGCACAACAACGGAATACAGAGTGGTAGACTTTCAAAACAACTCAAACATG
TGATTTCTGTACTTTTGTACGATAGTACTTTGTACTCTGTACTCGGGGCAGATTTACAAAAACAAGGAAAAGCAAAAAAT
AACAAAGAAGAAATACCTGTTGTATAGTGTTTGTAATACCAATTGGTCACGTGGGCCGTGGTATAAATTGGTAACATCTA
GAATGCGTAGTGGATGGCTCTGTTTATTTTCTTGCATCCTGCCATTCACTATGCTGAGCAACCGTCTCGTGTTTTGGCAC
GTGGCCAGAAGAACATGGTTTCCCCCGAGGGCAGTGTTGCAGCCTCCTTCTCTCATCCGTCAGACACGATGTCTCCGCGC
CGCCTCGGACAAAGCTGGGCCGAAGAAACCAGAAACATCCACACCCACGCGCCCCTACATAATTGAAATTGCGCCCAATC
TGCCATTTCCTAACCACGAACACATCCCGGTCTTGCCATATAAGGATTTTGCCAAATCTGGACTCGAGAGAGATTATTCC
ACAATCATAGCTCGGCTTACTGCTTCGTGGGGCAAACTTAAGATGGGCTCGCCCTGGGGCTATGTTGTTATCCGCGCCGT
CTACGGGCCCGGTACCGACGAACCGTGGCAGCGCATGCTGGAGAAAGTCAAAGAAGACGTGCGCGAAACTTTCGAATACT
GCCCCAACGCGGGCATCTTACCTGAACGCCATGTCTTCACGACCATCGAGGATGCGGCGCGACTCGACGGGGCGTCCTCG
CACGAGGTCCGCGACGTTTTCATGGAATGGGTTGTCGCCGAGAAGAAGATCTGGGCGAAGCCGCCGGATGTTGACGACGC
ACATTGCGGCACGCGGTACAACTTTTGCCTGTTTTTTGACGCCGCCTGTCTCAAAAAGATGGAGCATAGTACTTCTCTCC
AGGTGAAGCTCCTCTCGAAGAATGCAATGTACCTCGAACCCGATGAGCGCAACTACGAGATCTATCCGGGCTGGGAGGAC
GGCGAGACAGAGCACGACGAAGAAGACGTTGGGTGGATGTACCTGGTGTTTGAGGGTTACGTCGACTCGTACGCCTCATT
GGACGACCCGTCATGGTGGCATGACATGCAAGTAAGGGCCCCTACAGATTCTCAATCGCATAGTGACGTGACATGGAAGA
AAGAACTTTGTGCAGTGGACGACTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62