GenePrediction:GLEAN_2028 Details

Name: GLEAN_2028
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:211164..213594 (+ strand)
Length: 2431
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:211164..211194 (+ strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_108:211271..213594 (+ strand)
Length: 2324
>GLEAN_2028 class=GenePrediction position=GCSC_108:211164..213594 (+ strand)
ATGCCTGTTCGCGCTGCGCGCTCCAAGACGGGTAGGTCGCGTCCACGACCATTTTTGGTTCTGATCTCCGACCTCTAACC
TCTAACCTCTACTCTCGGACTCCACAGGCTGTCAGGCCTGCCGTCGCCGCAAAGTGCGCTGCGACGAGCAGAAGCCCGTC
TGCGGCGCCTGCACGCGGCTGCAGCTGCCCTGCTTCTTCCAGCCCGGCACCGGCCCGGCCGTCGAGACGCCGCGCTACCG
TGTTCGCTTTGTGCACTCGCCGTATTCGCCAGGACAAAACGGCAGTGTCCATGCCGGCAGCAGCAAAAACGACCAGGGCA
GACATGATGTCGCGGGCTCGCGCCTGCGCACTGCCAGTGCACCCATCTCGTCTCTGCTGTCGGGCCCGTCTGATCATCCA
GACGACTCCGTCCCGTTGCCACCACCACAATCACAACCACCTTCTCAGCTCGATGCTGCCTCAACGAAACTACAGCGCCT
TGATGGAGCCCGTCAACAGGTGCTGCCCTTGACACCTGACCCGGCCACGCCCCATAGCGTCTCGCCCGTCCAGTCTCGGT
CTGTCGTATCTCTCCATCGCCAGACTCAACACCCCCACTCCATGCACGGCCTCACCTACGAGAGCCACTCCATATCTGCT
CCGGCACCTATCATCGCTGAGCCCTTGGCGGCTAATGCCGATTCGATAGTTCAGGCCGGTCACGTGCCCACCTTCTTCGA
CCTCAACATGCACTTTGACCTGCTGGAAGAAAACTGGATGGCCATCGACCAGCCTTCTGACCCCTCTGCACCCGACCTGG
TTGCCATGACCTACACAGACACGCTGGCCGTGCATGCCACACCCGACTCCAGCTCTAATCCCTCCTCTGCACCCGTCTCG
ACTCCGACATCTGCCTCTGCTTCCCTCGCACGCACACCCACTCCAGCCACTCCCCAGGTTCCGGTTGTCATCGACACCGA
CGACCACGTGCTTATTCAGCACTACCTCAACGTCATGTCGCAATACACAAAGATCCGTGGCTCCGGCGACGAGAATATCT
ACACCCAGATCTTCAGCAACATGGCCCTCTTTTATGCTCCACTCTACAGTGCCATTATGGCCTGGACCGGGCTGCATCTT
GGCCAGCGCCAGGCCGAGTCGCAGAGCTTGCCGCAGCCGCAGCCAGAGTCGGCTCGCATCCGCCAGGCCGAGCGTCGATA
CGACCGCGCCGTCTCTCTGCTGCACGATGACCAGGATGTGGCCCACCATTTTGAGCTCTCGCTCGTGACCATCTGGTTCT
GCCTGCAGTTTGAGCTGCTAGCTGCTCGCGGTATCGAGTCGTTCTGCCACCACCTGGAGTTCACCGCCGACCTGGTCGAT
GCCCACCGTCGTCACCACCGTGCTGGGGGTGCTGCCGTCACCCTCAGCTCTGTGGGTGCCCGCGTGCTCGTGTGGCTCGG
CACCTACGACGCCCGTGCCACGTGGATCGGTGGTTCGGGCCGGTTGCTGCACAACCTCGAGCTGTTTTCCTACGAGCACG
ACTTCTTGGCCGCCGCCTTCCCTCTGGCAACCGACGGTACCGGAGACGGCAGCAGCCAGGCATCACGAAGTGCCTCGATC
GCAGCATCGGATGGAGGAGGTGGAAGCGGACGTGGAGGAGCAGAAAGAGCAGGAAAACGGAGTGATCCACCTTCCACATC
ACCGACATCATCGTCTCCGTCCTCGCCGGTATCCCTCCCGGACTCCTCGCCCTATTCGTCGTCGTCGCTGCAGACATGTC
TGCGACTGACGATCCAGTTCGACGCCGTCGACAGCCGTATCGCCCAGCTGCACCAACGCTCCGTGCCTGCGCCAGCGGCT
ATCTGGCTGGCCCTGCAGTCGGACCTGATTACGGCCCAACAGCGGCTGGAGAGCCGGCCGGCCGTGGCGCCCATCTTGGC
AGCTATGTTTGGCAGCGACACGAGTCCCAACACGGGTGCTACCGTCACATCCAACACACACACCCGCACAGTCCGGCCGC
CCAGCAAGATCACCACACACCAGTTTAACGATTTGCTGCTGTTGTCGGCCTGCTACACCGGAATCATCTGCTTCCACCGA
GTGCTGCCAGCAGTCGTGGCCCGAGACATGGCTCCGCAGCTGCGAGGACTGCTGGGTCCCCAGGCAGCGGCTACGCGTGT
CCTGCGCATAGCAGCATGGGTGAACCGACTGCGGGCGCCATCACCACAGAACATCTGGCCGCGCATCCTTTTCCTGGCTG
GCATCGAGACCACCGACCCGGTCTACCAGGACTGGGTCGTGCGCACGCTACTCGAGGCCGAGCAATGGGGCGGTAACATG
GCCAAGACGCGCACGTTGCTGCAGCACATAATCCGTCTCCAGACCCACGAGGGCGGCCGCATCGATTTTCTCGAAGCCAT
GCGGCAAACGACGGGGCTGTTTATCATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62