GenePrediction:GLEAN_202 Details

Name: GLEAN_202
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:193984..196524 (+ strand)
Length: 2541
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:193984..196524 (+ strand)
Length: 2541
>GLEAN_202 class=GenePrediction position=GCSC_167:193984..196524 (+ strand)
ATGCTTCCGGGGTTCCTCTTGTCCTCGTACCAGCATTACAAGCATGACACTGCCATCGTCACCTCTTGGCTTGTCAACAC
GGCCAAAGAAAATGGCTACGACGCTTCGCTAGCGGGAACCGCTGTGGCGAAGCCGTCTAGGCTCAAGGGCAAGGCCCGCA
AGCTTATGAAGGAAGAGTTGGCGAGATCTGGGAAGCACACTGGCGACGGTGTCAAGAAAGCAACAGGGCACAAGCATACC
TACAAATATGTGCTCCGAACAATCGACTTTGTTCCTCTTGCACAGTTCATCGCTGCCGTCACGAAGCCGAAGCCGGTGGA
AATGCCCCTGACGATGGCTTCGACCATCAATCGCGTCATCCGTGTGCGAAAGTCATTCGCCATGATTCTAAAAAAAGAAA
ATATTGAGACGGATGAAGAGTCAGACTTGAAGCACTCTCACTTTGTCAATGTACTTCAGCGAGTCCGCGATGTACTCCAG
CCTCTGGGCAATTTTTCAGGCTCATCTGGGGCACAGGGGGGGAACACACAGGGGTTGCCCGGTATTTTCACGGCTCTGCA
AGCCTACAACACGCCCGAAGGGTTCCCGGACATATCAGAAGACAGAAATCGTAATCCGGATCATGAGCCAGAGTTTGAGA
ACTCAATCGATGAGGCATACCTTGCCTTCTGCGCCTTGTTTCAAGACGCTCATACCCTCCGATCGTGCATCTTCAAACTC
TGGAACGGGTACCAGGATGGTGATCTCCACCTCGCTCCGGTCGCTATGGCGACTAACACGGCCATCCATCTGCTTCGTCA
GATGGAGGAGGACATGTCGGAGCTGGTCAACAGGCACGGTGGCTTTGGCTACTTTCTTGAAAGCTATTACATGACCGCCT
GCGTGGGGATGGGCGAAAATACCGAGAGAAGACAGCAGCGCGATGATGACATCAACACAGACACATACGATTTTGCAGAC
TACTTCATGGTCATCGTCTGGAAATGCCTCTCTGCATTTAGCTGCTCCAACCAGACCGAACAGTTTCGAGTCTACAACGG
GGACTTTGGCCATTTCGATCTGACCAAGGACAGAGACGAGCTGTCCAATGCCCAGAAATATAAGCAAGACAAGGCCGCTC
TCATGGAGATGCTCGGCGACATCACGGTGGCCATGACGTTCAAAAGCCCGTGCGAAGACGCCCTCATCCGCGGCGTGCGC
CATATTCTCAAGTACGACACTATCCCGTTCTGGGTCATCTTTGCTGCCCAAGTGTATCTCGATACACTTCACACTTTGCA
GGGCCCAGACGGCCAATACTTGCACCCCATCGAGGACATGCAGGCCAAGGCCCAAGACGTCTCGGAGTCGATGCGTGCCG
CGATGAAATACCATCGCGAGAAAAGTATTCGTGCTAAGACTTGGAGGGGTTCCAATGATGCCTCTCTTAAGCGCATCATT
GATTTCTGCGACTTCTGGGCTGCTGATCCTGTCGGGGCCCTCAAACAACGTCATGGGTACAGCTACACCCCCAATTTCTT
CTTCCATCATCACCCTCTGTACTGTGGCCTATGGATCCACCATGTCGTCAGTGCCTTTCACGAAGAAGGAATCGCCCTCA
CACAGGCCTGGGGTGGAACAGAGCACATGGGACAGCTTTACCACGCCATGAAGCGAAACGGTGATCTTGAGGCGAACAGC
TGGGCTGACATGGAGGTCCTCATGCGGATCCAAGTCATGGATAAACTCTTTGTGGATGGCTTCCCCGAGACCTTTGAAGA
GGATTTCATGAATTTCTGTCAGTGCTTGGGATACAAGACGGACGACTGGGTGCCACCCAGCCGAAAGAAGAGGAGCCGAG
GCGTCATCTCTTCTAAAGTTCCTCGGGTGTTCAAAAAGCAGGCGCCCGTGTCTATGCGCTTCAACCAGCTGCTCGGGCGC
AGCATGGATGGCAGCATGACGACGAAGGATATCATGCTGGTCCTCAGCGAGAGCCAGTGGACACAGATCGATGAGGATGA
CGAGCTCATCGTGGAGAGAGACTTTTCTTCGGGGGCGGGTGCAACGACCACTGAAGACGAGGACGGTGACGAAGCTGGGC
CGAAGAGGATTGCGCCCGCTGAACTTATGTCCAAGTTGGTCACGGCTTTGCAGGCCGAGGCGCTCGAGATGTCCTTTGAC
TACTTTTCCATGCACGTCTCCTGCTGGACCATGTTTGAGGCCATCCATGGTGCTCTGGAGGGCAAAATGCGCCAGCTGTT
CAAGAACACTTATATTAGCGACGTTAGCCGACTTCCCTCTGTCGTTGGCTACATTTTCATTGCGGCATCGCAGAAGCAGA
CGTGGCCCGGAGAGGAGCCGCTCGGCCTCATGCAATTGGCAGCACCGCCCATGAAGACGGTCATTGACGAACAGGGTAGC
AAAATTCATGACCAGCTGTACAAACACGGGATGCTTTGTGAGTACGCAGATGAGGAGAGCGAGGATGAAGATGAGGATGA
AGATAGCGACAGCGAAGACAGCGAAGACAGCCAGGCAGGATCGGAAGACGCTGAAGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62