GenePrediction:GLEAN_2030 Details

Name: GLEAN_2030
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:226823..231783 (+ strand)
Length: 4961
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:226823..229373 (+ strand)
Length: 2551
Type: CDS
Source: GLEAN
Position: GCSC_108:229466..230501 (+ strand)
Length: 1036
Type: CDS
Source: GLEAN
Position: GCSC_108:230592..231533 (+ strand)
Length: 942
Type: CDS
Source: GLEAN
Position: GCSC_108:231663..231783 (+ strand)
Length: 121
>GLEAN_2030 class=GenePrediction position=GCSC_108:226823..231783 (+ strand)
ATGGCGCATCTACAGATACCACTGCAGTCTGCAGACTTTATACCGGACGTCAGCCAGCCGTCGCAATGGCCGAATCATGT
GGCTGCTATCATCCGTTTCATCGCCAGAGGTGACCTCTTCTTGGCTTGCGCGGGAGTTTCGGTTCTTCTGCTGCTACTAT
ATTTGCATTTGTGGACCGTCCGCAATAAGAAATTATGGCGGCAGAAGACGCTGCCAAAAGCCACCGATACCTCGGATGAC
CGATCAGAATTCGAAGAGCTTCTCTCTGCCGATTCATCAGTCTCCGAGGACGACACGCTGCACACGTCTTCCTCCACGCC
AATAGAAAATGAAGGCAGCCTTTTGTCCTTTTTCGCCGTTTCTCTTTCACAGATCGTCGCCGTTGCCGTGGCATTCGCAC
TATCCGTCATCAGCTCGGCCAGAAACTCATCGCCTGGTGCCGCTTGGAAAGAGCCGGTCACTCTAGGCTACCTGCTGCTG
CTGTGTGTTATTCAGTTGCTGCTTGCCAGCAGTCGTCGTGGGTTCTCGCTTCGTCATGTCTTCTATCACCACATCAACGC
CGTTGGCACCGCGTTGACCGTGCTCAAGGCCGTGTGTCTTCTGTTGCCGCTTGCACTGCGAGGAACGCACGCACGATTGG
GCGCCGTCCCAGGTGCTAAGTTGGCCGCCCTGTCCGCCGTTCCGTTGACAGCGTTTGCTGCACCGCGAGATGGTTCTCGT
GTCAATATCTCCGCGAGCTTTGGTGTTTCTGCCAAGAGCAAGAGTGATATCCATGCAGACCAGGAAAGTGGAAAGACGGC
CGGCAGCCTGCCTCTTTCGCCGGAAGAGTCGTGCTCCTGGGCGTCATACTACCTCTCGTACGGGTGGCTCACACCAGTGA
TCCTGCACGGGTGGCGACGAGACCTCGAGCTCGACAACCTGCCGGCACTACCGTCATATGACGCCCCTCTGAATCTGCTG
GAGAGAATGGGACGGCAGAGACAGCGGCAGCGGCACAGACGAGGAACGCTAGCGACGCTATGTCTGGTGTTCCAGGGGCA
CATCAGACGCATCATGATTTGGGGCACACTGACAGCCATGGCTGAATATGTGGCGCCGGTAGCCATGTTCCAGCTGCTGG
CGTATCTGGAGGCAGGTAGCAGCTCTGCCATTCCGGTCCATCCGTCTGTGTGGGTCGGGCTTCTGTTTATCGGTCCTATG
CTGCGGTCAGTATGCTACCAGCAGTCCATCTTTCTCAGCACGCGGCTGCTGGTGACATGGCGGGCGTCGGTGATCCAGGA
GGTGTTCCAACGGATGCTGCGCTTGCGCGTGGACGGCTCTCCGGCCCAGCCACGGTTACAGCAAAAACAAACGCAATCCT
CTGGCCAGAAGAACACAGTCAAGACAGAAAGTCTGGTGTCATACGACGTAGACATGATCTCCAACTCGTCAGACATGTTC
TATTCGTTCACGGCCAGCCTGGTGTCGACGGCGCTGGCGATGACGTTCCTGTACCGACTGCTGGGCTGGCCTTCGCTGCT
TGGGGTGGCCGTGCTGGTGTGCCTGACACCGCTGCCGGTGGTTTTCTCAGGGCGGGTATCGCGGCTGCACAGACGGGTGA
TGCAGGCGACAGACGCACGGCTGGCGCAGGTGGCCGAGTTTCTGGGGGCTGTGCGCACGCTCAAGTACTTTGGATGGGAG
CCGGTAGCGGCAAGAGCATTGAACGAGGCCCGGGCGACAGAGCAGCGGCAGATCTGGCGGCGCAACTTAACGTCGATGCT
GGTGGCGATGACGGGCGATATGATGTCGCTAGTCAGCCTGCTGGTGATGTTTGCAGCAGTAGTGCTGCTGGCAAGACAGC
CGCTTCACGCACCGGCAGCCTTCACGGCGCTGTCGATCACAGAGACGCTGCGGGCGCAGTACGTCTGGATGGCCAAGGTA
GTGCAGTGGGTGGCGCAGGGCAGAGAGTCGTTCCGGCGCGTGGACGGCTTTCTGAGCGGTGGTGAGCCGCGGCAAAGACA
TCCAGTTGGGCCGCCGAGCTTTGCGGGAGCGGATGTCGTGGTGGGGCGAGAAGAGAGTGAAACTGCAAACGCGCCCTCGC
AGCCACCGTTTTCCCTCCACCTCTCGGTCAGCTTCCGCGAGGATGCCCTCAACGTCGTGACCGGGGCCACCGGCAGCGGA
AAGTCGACGCTTCTTCTCTCGCTGTTGGGCGAGACGGCTCTCGTGGCTGGCACAGTGACCTGTCCGGCCGACGTGGCGTT
TGTGCCGCAGACGGCCTGGCTGCTCAGCGGCACAGTGCGCGAGAACATCGTGTTCCACGGCACGCACGACGACGTCCGCT
ACCGTGCCGTCCTCGCCGCCTGCGCCCTCGACCGCGACCTCGCCGCCCTGCCGCTCGGCGACCAGACATTCATTGGAGAG
CGAGGCGCTGCATTGTCGGGCGGCCAGCGTCAGCGTATCGCTCTCGCCCGCGCTCTGTACGCGCCCCCGACCGCCCTGCT
GCTGCTCGACGACGTATTTTCGGCTCTGGATGCCCACACGGCCGTGCAGGTGTACCGAGGTTGCTTTGGAGGTGGTGGAA
TGGGAAACCAGGACAGCAAAAAACAAACGGTCTTCTGGCTGGCCGTACCGTCATTCTCGTCACGCATATGGCGGCGGCCA
TAGCGGCGGCTGATGTGGTCGTGCGGCTGGAACACGGCCGGGTGGCGTCGATGACAGAGCGATGGAAGAAAGATGGAGGC
AGACATGTCGAGGGATTTGTCGAGGAAGAAGATGAGGATGTTGATGAAATTTTGGAAGAAGAAGTAGACAGAGGGGAAGG
TGCATCTGGGGAAGGTACGGCGGAGGAAAGAACGACCGAGGAAGGCGTCAAAGCCTTCGCGTCCGATCATTCCAACTGGT
CACCATCCATCACGGAAAAACGAGCGTCTGGTCGGGTTCCACGCTCCATGATTGTGCAGTACATGCTGTTGTTTGGCGGC
GTGCCCAACGCGCTGCTGGCCATGGCCGGATCACTGATGGTGCAGCTAGCCTACTTTTCCATTACGCTATGGCTATCAAT
ATGGACCAGCAAGGAATCGTCTTCGTCTTCGTCCTCGTCGTCCTCATCCTCAGCCCATCTGCTCGTCTACGCCGGCACGG
TGCTGACCTTTGTCGGTCTGCAGCTGCTCAACAACTATCTCTTCCAGCGGGGCGGCTGGCGGGCGGCGCAGACGATGCAC
AGCCGCCTGGTCACGGCCGTTCTGGCAGCACCGCTCAGCTGGTTTGACCGCACGCCAGCAGGCCAGATCCTCAACCGGTT
CGGGCTCGACACGCAGTCTCTAGACGCGGTATTGGTCGACTGGCTGCGCATGACGCTCGACAACGGACTGCGGTTCGGGC
TGCGGCTGGCCGGCATCGCGTCCATCCTGCCGGTCTTTGCGGTGCCGGCAGCCGTGTTCTGCGGGCTCGGTTTTGCCACC
GGTGAGCTGTACTCACGCGCCGAGATTTCCGTCAAGCGACTCGTGGCCGCACACTTTGCCCCGGTCCTGTCGCAGTTTGC
CGATCTCGATGGCGGCGGCAGCCTCGACAGCGGCCTCGCCGTCGTGCGCGCGCGTCGCGGCCTCGATCGCGTCTTCCGAC
AACAGCTCGCTGACCACGTCTCCGACCACATGCGCGCTGCCGAGGCACAGTTCAACTGCAACCGCTGGGTGTCGGTGCGG
TCCGACCTCTGCGCCGCCACCATCGCCGCCGCCGCCGGCGCCATCGCCTGCTACATGTCCACAAGCAACAACGGAAATAT
TGGACACAGCAGCAGCCGCGCCGGTCTTGTCGGCTTCTCGCTCACCAACGCCATCGGCCTCAGCCAGACCATCCTCACAC
TCGTGCGCAACATGAACGAGCTCGAGGTCGAGCTGAACTCGCTGCAGCGCATCGACCAGTACACCCACATCCAACCCGAG
AAGGACGTCGAGATGGCCGGCGACGACATCCCAACCGATTGGCCAACAGCAGGAGAAATCTCCTTTGACGACGTGACGGC
GACGTATGAGGCAGAGGACGGCAGCAGTGACCCCAGAAACAAAAACCCCACCTCCACCAACAGCAACATCCTTAACGAAA
ACTCTTCATCCTCTACTACCACCACAACATCCTCTCCTCCTCCTCTCGGTCACGTCTCCTTTGTGGCTCATCCTGGCGAG
CGTCTGGCCGTGGTCGGCCGCACCGGAAGTGGCAAGAGTACGCTACTACGCACTCTACTGCGATCTACCCACGTGGTGCA
GGGCCGAGTCTCCGTCGACGGCATCGACATCCGCCGCGTGCCGCTGCGCCGCCTGCGCCACGCCGTCTGTCTTATCCCCC
AGGACACGCTGCTGCTGGCTGGCGACGTGCGGTCGAACCTGGACCCTGAGGGTGACTGCACGGACGAGGAGCTGGTCGAG
GTGCTGCGGTCATGTGCCGGCGACACCGCCAAGACGGTCCTTTCGCTCTCAACACCCGTCGCCACCGGCGGTACCAACTT
TAGCAGCGGCCAGCGTCAGGTCCTCGGGCTCGCCCGCGCCCTCTGTCGTCGTGCCCGTGTCGTCGTTCTCGATGAGGCCA
CTGCGTCCGTGGATCTGGCCACCGACCGCCGCATGCAGCAGCTGATCCGCACAGCATTTGCCGGCTCGACTGTCGTCACG
ATTGCGCACCGTCTGCGCACCATTATGGACTACGACCGCATCCTAGTCATGGCTGAGGGACGTGTCATTCAGTGAGTGCT
TCTTGTTCTGTGTGTCCCGATTTCATTCTCGTTTCAATTGCCTATTTTTCTGTTTTTTGCTGTATCTTTTTTATTTTCTT
CACCTCTTTGGATTTTGTCTTCCTTTTACTCATTTACTAGAATCGGCTCACCTCGCGAACTGGCCACCCGCCAAGGCGTC
TTCTCCGACATGCTCAAGAGCACGGGCGAGTACGAAGAGCTGCTGGCCACGGTGGGCTTGAATGCAACAACACTGGAGTG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62