GenePrediction:GLEAN_2032 Details

Name: GLEAN_2032
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:234081..237136 (+ strand)
Length: 3056
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:234081..234173 (+ strand)
Length: 93
Type: CDS
Source: GLEAN
Position: GCSC_108:234427..236019 (+ strand)
Length: 1593
Type: CDS
Source: GLEAN
Position: GCSC_108:236073..237014 (+ strand)
Length: 942
Type: CDS
Source: GLEAN
Position: GCSC_108:237074..237136 (+ strand)
Length: 63
>GLEAN_2032 class=GenePrediction position=GCSC_108:234081..237136 (+ strand)
ATGTCCAGCGTCAAAGACGAGCCGCACTCGCCCGAGGCCGCTGCTGGGACAAGGGACCTGACTTCAAGCGATTCCGGCTC
TGAACGAGATACGGTACGTCCTTGCCCAATTTTTGCTGTCCGACGTACATCTGTGGCCACCTGTCCGGACGTTACGCTTT
CCTTCTGCCTGACCTTCATTTGTCCCCCGACGTCTGAGCTGCAAGGATGAGACAGTTGTAATTGCATGATCTTCGTCGAC
CCGATACAGGTGATGCCCGGTGGGGATGAGGCCACCGTCTTTTCGGACTTGACACGCTTTCCACACTCCCAACATCTGGT
TGGCTAACGCTCTGACACGCAAACAGGACACATTCGAAGATGCCCCCGACAGCGCCTCCATCCGCTCGCTGACAAAGCGG
TCCCTCCCATCCCAATCACCACCACCACCTGCATCTCCCGACAAGGACGAGTCAGAGTTGGAAACGGAGACGGAAGCGGA
GGTAGCCGCCGATGGCAACGAGTCAGAGAAAGAAAGCGGTGACGAAAAGGACCAGGATCAGCGCGTTGAGGAAGATAGCT
TCGAGGAAGTCAACGTGCCCATCGCTGCAGCGGCAACGTCCGACACCACACCGACAGAAACCCGGAGAGTCCCCAATATT
GACATCGACCACGAGCACGATGATGAGGATGACCATGACAACGAAAATGATCTCGACACCGTCACCCTGAGCGACGACTC
AATCATGTCCGACCACCCGCCGGCTGTTCCCGAAAAGGAGTACCCTTCCAAGACTTCGGCCCTGGGCAGCTTTCCCTGGT
CTCCCTCGTCGGCCACCAGCGAGCCGACGTCCAAGCCCGTTCCCAATCCTCCGAGTTCCGCCCCCCTCGGCGCCCCTCCG
CAGCAGCTGACGCGGAAGCTGACCAGCCCCTTCTCGTGGCTCTCCCGGGGCTCCGCACAAAAGGAGGCGTCTCCACTACC
CACACCGTCTACCTCACCGCGGAGAAATACTGCCAGTTCCGTGACCACCATGGCGAGCAATCCGGAGATGATGCTGAGCA
AGCTGGATGAGGAAGGTGGTGTGAGACGAAGCATTGGCCGAAAGAGCCTGAAGGACCGCTTCAAGATCATCCGCATGCGG
GAAGAAGCCGGCATCATTGCGCTGCCCGACGAGCTAGGCAACACGACTAGCGATGCCGTGTCCGAGTCGGGCAGCCCGCA
CATCAGGATCACCACCACCCGGCTCAGCGTTCCTGTCGGGTCGGCCGATGACTTGCGCCCGGCCTCGCCCATCCCGACGA
GCCCGAATCCAAGCCTGGCTCCGGGGACGGTGTCTGGCGTGACGGCGGGGCCGTCCAGCAGCGGCGATGCCAGCGTCGAC
TGGGACATGTGGCAGTCAGTCATCTACGAGGGCCCGGCGGCAGTGGCGCGTTCAAGCCCAGAGGAGCTCAACCGGGCCAT
CGCCACCGGTATCCCCAACGCGATCCGCGGCGTCATCTGGCAGGTGCTGGCCCAAAGCAAGAACGAGGAGCTGGAGGCGG
TGTACCAGGACCTGCTCGTCCGGGGCACCGATCGTGAGAAGCAGCGTCTGAGCAACGGGCACATGAACGGTGCCAGGGAG
ATTGTGACCTCGTCGTCGTCGTCCATCCACTCGGGCGATTCGGGGTCCGGGTCGGCCTCGAGTGCGGCCAACGGAACCCT
GTCGACTGGCTCGGCCGAGAAGGATCTCGATAAGGCGGCCGAGCGCAAGAAGAAGGCCAAGGTCGACGCAGCTGCCCTCA
ACAAGCTGGAGAAGGCGATCCGCCGCGATCTCGGCGCGCGGACGAGCTACTCTAAGTTTGCTGCCGCCCAGGGCCTCCAG
GAAGGCCTCTTTGGCGTCTGCAAGGCCTACGCGCTGTTCGACGAGGCCGTCGGCTACGCGCAAGGCATGAACTTTTTGAT
CATGCCGATCCTGTTCAATGTGAGTGATGCGTCTTGTTTCCGTTCTTCCTCGTTTACTTACACATCGTCTAGATGCCCGA
AGAAGAGGCCTTCTGCCTGCTCGTCCGGCTGATGAACCAATACCACCTGCGCGATCTCTTCATCCATGACATGCCCGGCC
TGCACAAGAACCTGTACATGTTCGAGCGTCTGCTGGAAGACCTCGAACCGGCGTTGTACTGCCACTTGCACCGCAGGGGT
GTATCGCCACACCTGTACGCGACGCAGTGGTTCCTGACGCTCTTTGCGTACCGGTTCCCGCTGCAGCTAGTGCTGCGGAT
CTACGACCTGATCCTGTCGGAGGGTCTGTCGGCGATCCTCAAGTTCGGCGTGGTGCTGATGCAGAAGAACGCGGCCACGC
TGCTGGGCATGTCAGACATGTCGCAGCTGACAACCTTTCTGAAGGACCGGCTCTTTGACGTGTACATTGACGCGAGCCCG
AGTGCGGGCAGCATCCTGGAGAATGGCTTCTTCGGCAGCTCGTCGTCGAGCCTCGACAAGGAGGTGTACCGGGCGGATCA
GTTTGTGCGGGACGCGTGTGAGGTGAAGCTGACGCCAGAGCTGGTCAAGGCGTACACGGCAGAGTGGGAGGAGAAGACGC
GAACGGAGCGGGAGCGAGAGACGGAGTTGGACCACCTGCGATCGTCGAACGCGAGCCTGACAAGGCGGGTGCGCAAGTAT
GAGGAGCGGCTCGAGTCGGGGGACCGGGAGCAGACGGCGCTGGCGACGGAGCTGGTGCACACCAAGGTGCAGAACGAGGA
GCTGCGGGACGAGAACGAGAGCCTGAAGGGACAGGTGCGGGAGCTCAAGGTGGTGATCGAGAAGCAGCCGGAGGAGCTGG
AGCTGGCGTGGCAGGCCGAGCGAGACAGCCTGATGGAGCGCAACACGCGCGTGCACGAGGACAGCCTGCGGGTGGAGAAG
GAGATGAGCGAGCTGGAGGAACAGCTGGTGCAGACGAAGATGCGCTATGCAGAGGTGCGTGGTTGTGCCGGTCCTTTTTT
CTGACATTTTTGACATTGGCTAATTTGTTCCAGATCAACTCCCAGTACGAAACTCTCAGCCGGAAATGGTCTGACCTGAA
GCGGCAGTTTGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62