GenePrediction:GLEAN_2034 Details

Name: GLEAN_2034
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:245670..250446 (+ strand)
Length: 4777
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:245670..245752 (+ strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_108:246069..247173 (+ strand)
Length: 1105
Type: CDS
Source: GLEAN
Position: GCSC_108:249454..250446 (+ strand)
Length: 993
>GLEAN_2034 class=GenePrediction position=GCSC_108:245670..250446 (+ strand)
ATGACGCCCCCACACCGTCGAATTGGTCCGTTCGTGGACGTGGACTTTGCCCTGAGACGCCAATTCAACAAGACCTCTTT
CCGGTATGTCCCGTGCTTCGTCAGCCAGAGTCCAGGGCAGCGCACTGACAGACAAGGCACCCCCAACGAGAAATCATCGA
ATCTGCACTGGAGGGCCACGACGTGGTCGTTTTGGCGGCGACGGGGTTCGGGAAGAGTCTGTGCTTTCAGCTTCCCGCAG
TGATTAATTGCGGAGGTATGTGGTCAACAAGTCTGCAAACACGGGCTGAGTCCTGCTGACGGACCAGTCACAATCGTTGT
ATCTCCGCTTCTGAGTCTCATGGTAAGACATGCGAGGCACGGCAAGGCTTGAGTCGAATTAGCTGTGATGTTGACCCAGA
CAGATGAACCAGGTCGGGGCTCTCCGCAAAGCGAACATAGACGCACGCACCCTCAACGGCTACACGTCGGCCGAGGAACG
CACGAGCATCTACCGCGACCTCGCTTCGGCCCACCCGCGCATTCGTCTGCTCTATGTCACGCCCGAGCTCTGCTCGAGCA
GCCGCTTTCGTCAGCGCATTCACCTGGTGCACGAACAGTGCGAGCTCGCCCGTGTCGTCGTCGATGAGGCACACTGTATC
TCGGAATGGGGTCATGACTTTCGCCGTGATTTCGTCAAGCTCGGATGGTTCCGCCAATCGTTCCCGGATGTCCCCATTAT
GTGCCTGACAGCGACGGCCACGGAGCCCGTTCTCGACGACGTGCTGGAAACGCTCGGGATCGGCGTGCAGAACACACTGA
CAGCACGGAGACGAGCATCCCAGTCACAGCATCTGAAAATATTTCGCCTCTCACCGTTTAGGCCCAACCTGTTTTTGGCC
GTGCAGTTTGTGTCTAGCAGCGAAAAAGGAGAGCAAGATCGTTTGACAGATTTTGTTGCGTGGCTTCATGGTCTGCATCG
AAAACCGCTGAAGCGAAAGAGACGTCTTCTTGTGCATGCGTCACAGAGCCAGGACACCGAGGTGACAACGGTCCCATCAG
TGCCAGGAATCATATACACGCTGTCCAGAAACGAGTGTGACTGTCTGGCTTCGGCCCTGAGGCAGAAAGGCATCGGCGCC
CGTCCTTTTCATGCACAGCTGTCTCGTCAGGTCAAGGAAGAAACAATGGCCAAGTGGCTGAAAGACGAGCCGGGATATGC
AGTCATTGTGGCGACAACTGCCTTTGGCATGGGCGTCGACAAAGAAAATGTGCGCTTTGTCGTGCACTGGCGCCTGCCCA
AGTCTTTCGAGGGGTATTGCCAGGAAATCGGACGCGCTGGACGCGACAGTCGCCCCGCCACCTGCATTCTGTACTACAGC
CGCGGAGACGGAGAGCGCGTGTCCAATTTGGTGGCCAGAAGTGGAACGAGGGCGGCAGAAACCAACCACCAGGCCGCTAG
ACGGGCCAGTCTCAGCAAGCTGATCGAGTATTGCGAAGCCGCTGACAAATGCCGGCATGCAGCTGTATGCCAGTATTTCG
GCCTCGAATTGGACCAGCCATGCGACTATGCCTGCGACTGGCATAGGGACCCTCAAGGCGTCAAAAGGAGGAAAGAAGAA
TATCTGTCCAAAGAATGAAAGAGTTTCGATTGCTACTCGGACATGTTGATGGAAAACTGAAAAGGTGCGCCGTCCCTCAC
TCTTGAAGCTGACTTGAGTTCAGAAGATATTCGGTGCCTTTCTCTCTTAGATTTTTCGTGTTCTGATTCCATTCCAGCCA
GACGAGGCCTTGCGTAACACAGTCGGCTAGATCGTCGATCTTGCTTAGCTGTATGCTGGGTTGAGAGCTGACGTCCTTTG
GCTTTCTCCTTGTTTTCTTCTGCTTCGCATCCCATCGGGCCAAATATGCAGCGACCATCTCGCTAACATGACCGTCCACG
TCGTATGAAAGGAGGCGATTTGCCTTCCCAGCACCCGGGCGCAAAAGGGCGGCCACAATTGCCTCTTTGATATCTTTGAT
GTCTTTTTCTTTTGTTGCCTTGGTGGGGACGGATACGGAGGCTGGAAGCTTACCAGCCAACCCTCCGCGGACGACAAATT
GGGCTATCCGTCGTGGGCTGGCAGCTTCGACAGAGCTCAGAGATACAATGCCGCTGTCAGTTTCGGTGATCTGTCTGGCA
GCGAAAATGCCGTGAAGCATGGCTTCAAGCGAATTGACCCGAACGGTCCACTCGAGTACGGCAGCAGCACCGCCAGATCG
AAAGCGCTGCCGCTCTATCACGACATGTGAAGGCATCAAGGGCAGCAGGCGGTCCTGAACAAGACGAGCGGCAACAGCGG
CCATGGGGCCGGGGGGGAGTAGGGACAAGGAGCAGGAGAGGAATCGGCTTCCGTGCTATTCTCTTCCACCCCCGACTTGT
CGTCGTCAATCAGAGAGAGCCTCTCCCAAGCCAGGAGCCTGGGGATGCTTTCGCCAGGACTGACATGCAGCAGACAGTAT
GCCAAATTACGGACGCCCATATCAACGGAGAGAACACGATAGCCATCCGACTTAGTTCCAGCTGTTGCCTGGATGTTCTG
CAAGTCGGCAAGCAGGACGGCCTTGGTTCCCGACGTGTTGCGACCACAGAGCAGCGCAAGGTCGCGAAGCTGCTGGAGAG
AGAATTTGGGCACGGCAGTGCTGCGACTGCTGGTGCTTTTTTGCCTGCTATGCCGAAGAAAACTAAGTGTGAATGCACTC
GCCAAAAAGAGAGGACGGGCACGAGGTCGCATAGTCAGCTGCAGACCTCGCATCAAAGCTTCGGCGATGCGACCATTCAG
GTTCAATGCATACATGGCCCATGAGTAATCCCACCCGGTGGTGTTGTGATTTGGAATACGGAGTAAGAATGGTGGAATTT
GCACTGTCAAAGTGGAATTTCATTCTAGCCGCCTCGCAGAACGTGCAGAACCGGCAGGTTGTTGGGCCGTCCAGCCGCAC
AATAGCCACTAAAAGATTCCTCAGCGACCCACCTATTCCTAGCGGCGCAAGGCTTTCCAAGGCCGAGGAATACGGGAATG
ACAAATGACTTGAACGCGATAATGCGTATGCAAAAGGATATAAATACCTTACAAATGTCGTCATTGCAAGCTTGTGTACG
CCGACAGTTCTCTACACTGCATCGTCTGCGCAGAACAAATACATACGTAGCGCACACTTCGTCTATGAGGGCATTTTCTT
TACTCTCACGAGCTTCAGTTTCACGTCCACGACAGCTTCTACCGTCGGCCCCGCCCCCACCTCGGTCTCGTTTTGCAGCA
CTGGCCTCGACATCCTCGACCTTTGCTGCCTCCTCTCGACTGGCCTCGCTCTCCAGACAGTTTTCCTCGTCGGCTTCCAC
CATGGCTCCGATTAGCAAGGAAACCGACTACCTGGTCATCGGTGGCGGTAGCGGCGGTTTGGCGTCGGCGCGCATGGCCA
GCTCGAAGTACGGCGTCAAGGCAACAATCGTGGAGGGTGCCAGACTTGGCGGGACTTGCGTGAACGTGGGTTGCGTGCCC
AAGAAGGTCACATTCTACGCGGCATCGATCGCCGAGGCGATTCACGAAGCCAAGGCATACGGGTTCTCGGTCGAGCAGAC
AAAGCCTTTTGACTGGACGTCGTTCAAGAACAAGCGCGACGCCTACATCAAGCGGCTCAACGGTATCTACGAGCGCAATC
TGAACAACGACAAGGTCGACTATGTGCGTGGCTGGGGCAAGCTGCTGAGCCCGACAGAGGTTGCAGTGACGCTGGACGAG
GCCGATGCGGCGGGCAACAAGGAGGTCATCATCCGGGCCAAGAAGATCCTCGTGGCTGTGGGTGGCCGGCCGGCCAGCCC
GCCAGACATTCCGGGCGCCGAGCATGGCATCAACAGCGACGGCTTCTTTGACATCGCCACACAGCCCAAGAAGGTTGCCT
TGGTCGGTGCCGGCTACATTGCGGTTGAGTTTGCTGGCATGTTTAACGCACTCGGCACTGAGACCCATCTGTTTGTCCGT
CACAAGACATTTTTGCGCAGCTTCGACCCGATGGTCCAGGAGAGCGTCACGGCCAATTATGAGCGGCTGGGCGTGCACCT
GCACAAGGAGGCCACTCTGACGCGCGTCGACAAGGACGCGACGACGGGCAAGTTGACGCTGCACTACGGCGATGGCAACA
CGCTGAGCGACGTCGACACGCTGATCTGGGCCATTGGCCGCACGCCGCTGACTAAGGACATTGGTCTTGAGAAGGCAGGT
GTCGAGGTGAACGAGAAGGGCCTGATCAAGGTGGACGAGCTGCAGAACACGTCTGTTTCCAACATCTACGCACTCGGCGA
CGTCACGGGCCCCGTGGAACTGACGCCTGTCGCCATTGCCGCAGGCCGGCGGCTGGCGCACCGGCTGTTCGGGCCGTCCG
AGTTCTCAACACTGCACCTCGACTACAGCAACATTCCGTCGGTGGTGTTTTCTCACCCCGAGGTCGGATCGATCGGTCTG
ACGGAGCCGCAGGCGGTGGAGAAGTACGGCAAGGACAACATCAAGGTGTACAAGACTAGCTTCACGGCCATGTACTACTC
GATGATGGAGCAGGAGGAAAAGGGGCCGACGGCATACAAGCTGGTGACGGTTGGGCCAGAGGAGAAGGTGGTGGGGCTGC
ACATTCTCGGGCTGGGCAGCGGCGAGATGCTGCAGGGCTTTGGTGTGGCCATTAAGATGGGTGCGACCAAGAAGGATTTT
GATAACGTAGTAGCGATCCACCCGACGAGCGCAGAGGAGCTGGTGACGCTGAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62