GenePrediction:GLEAN_2036 Details

Name: GLEAN_2036
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:261444..262908 (+ strand)
Length: 1465
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:261444..261879 (+ strand)
Length: 436
Type: CDS
Source: GLEAN
Position: GCSC_108:261953..262908 (+ strand)
Length: 956
>GLEAN_2036 class=GenePrediction position=GCSC_108:261444..262908 (+ strand)
ATGGAGCCACTACCGAGCTTCTCCAGCATATATGCTGGCGACAATTTGATTCCGGAGCCTGTTAGGAACACGGAAGCTCA
AACAGAAGAACCGGAAGTGATCATTATAGATGACTCTACCCCGACTCAAGCTAGCATCGCATCCCCCAAGCGGACTAGAG
AGTCCTCTCTCGACATGAGCGACGAGCGACCCAGAAAGTCTCCGTATAGCTTCTTTTCCTCGGGCAGCCTTCGTGCAGAA
TTTCTTTTGCAGCCCGTTGATATCGAAAAATCACAAACAGAAGAACCGGGAATGGCCATCATAGATGCCTCTACGCCGAC
TCATGCTAGCAGTGTCCCCCCCGAGAGAACCATAGTATCGCCTCTCGACTCGAGCGAGGACGAGTGGCCCAGAAAGTCTG
CGGTTGACGGTTTGCGACGATTCATTGTTCATCCCAGTAAGTGCGCCGAAAAGAGCGTACAATGATGCGTCTTTCTAGAG
CAGCCCTGGTGCTGACGGACACTTCTCAGAGACGATCCAAGTGTCCTTTGATGACATTCACGTCCATTCGAACACGATCG
AGGCTCTTGGGAACCTCACCCTGGCGCTCGACTATCCGGACGCCTTCAGCTACGGTATCTTGTCCAAGGGTGCCCCGCCG
TCAGTACTGCTGTATGGGCCACCCGGGACTGGCAAGACGCAGCTCGTCCGCGCCCTCGCAAAACAGGCCCGCTCCAAGAT
CTTGGCCATATCTAGCGCCGACATCCATGACAAGTATGTCGGCGTCGGTGAGAAGATGATCAAGGATTTGTTCAAGCTTG
CGAAACGGGAGCACCCTTGCATCATCTTCATCGACGAGGCTGACTGCCTGTTCCGCTCGCGCTCGAGCGAGTCCAACAAA
AACTACCAATCGTATCTCAACGAATTTCTTGTGGCCATGGATGGGATCGGCTCTCGGGGCGCCAGGAGCCCCACCATCGT
GGCGGCGACAAACCGGCCGTTTGATATTGATGAGGGAATCCTGCGGCGCCTAGGCCGGCGCATCATGGTCGGCATGCCAG
ACGCGGCGGCACGCGAAGAGATCTTGAAGATCCACGTGCGCGGAGAATCTCTGGCTCCCGACGTGAGCCTCTCCGACCTG
GCAAAGGTCACTCCGAACTACAGCGGCTCCGACCTCAAGAACCTCGTGTATTCGGCCGCCCTGAGGGCCCTGCGGGAAGA
AGCAGACCAGCCCCAAGCTCAAAACTTGGCATCTGGTGCCCCGGCGGTGGATGACAGCTCTGGCTCAGCGGAAAGATGCA
AGATTGGCTGCGGCCGCGTCCTGCGCAAGGAACACTTTGCCTACGCCAAGCGCGAGACGCATCCGTCCCCGGTGGCGGAT
ACGGTGGCCAAGATTCAGGAGTTCCACAACAAGCATGGCGATACAGTGCAGAGAAGCGGCGCGAGCGGCCCAGTGAACAA
GTCGAAAGCGCCTGTCTCATGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62