GenePrediction:GLEAN_203 Details

Name: GLEAN_203
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:207373..210316 (+ strand)
Length: 2944
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:207373..208476 (+ strand)
Length: 1104
Type: CDS
Source: GLEAN
Position: GCSC_167:208532..208871 (+ strand)
Length: 340
Type: CDS
Source: GLEAN
Position: GCSC_167:208933..209403 (+ strand)
Length: 471
Type: CDS
Source: GLEAN
Position: GCSC_167:209454..210316 (+ strand)
Length: 863
>GLEAN_203 class=GenePrediction position=GCSC_167:207373..210316 (+ strand)
ATGAAGAGTATAAAGAGGGAACGCAAAACCGTGGAGAAGCATTTTCTCAGGACCGACGAGGGCATCACCTATGTGCAGAA
CGACGAATTTGAAAAATCGGCACCGCATGCCACGAGAACTCACCTCCTCGTTGCCCTGGACTCTTTTGACATTCCTGCTT
CCCATGTCAGCAGTTCTGACATGTCAAGCGTAGACCAGGGGTCAGATACCCTATGCCCGGGTCGTGGTAGCAGCCTAGAG
GCAGCCAGAACGAACGCGAGAAAGCAGACGCCCACTTGTTTGCGCCTTGTTAACAGACTCCTATGTATAGAGCTGTCTCG
CATTTGTGATTGCGATGTGGAAAGTGACCACAGTGCACCCTTTGAGGTCTTGCTTTTGGCTGAGGAGAAGATCCGCAAAG
CTTATGCCGAAAAGGAGACCGAGTTCGCAGAGATACGAAGCCGCTTTACCGGCCACCTGGCAGTGCTCCGAACAGAATTC
TATGAGCTTGCCGGTTTCAGCGTCGCCGTCGATAACCTGGATGAGGAATCAAGGATCGATTCCATAAGTCGTGCTAGGAT
TACGCTGGACGGCTTTCGGGCCTTGATGGTCCTTTTTGACACGAACTTACGCGGTTTTTCTGAGACGGCGAAACGAGTTC
AGCACGATAGGACAGCCCCCAGCCGCGACGCTGTACCTGTGCCTGAGTTGCCCTTCTCTCATCTTTACTACCTCTTTGGT
CCTGGCGATACGATAGTGCGGCTAAACCCCTATCCCCAGGCCTATCGCGTTACTCGGGTGTATGGAGGCAGCACTACCAG
CCCACTGTCTGGTCCCAAAACTCGCATCCGACGGAAAATCGCAGACCTGGTTGTCATGTGCTTCCATCTAGATTATGATG
GCAAGGAGTTCGGTCCTGTGCACACGGACTTCAAAATTCGGCCGTACATTGGTGCCCAAGCTGTTGTCAGCCTTTGCGTT
TTCCCGCTGTTTTATGCCTCCCGGGGCCTTCCGAGCTGTCTCCTGGAACGCGGTAGAAAGATGCATTCGTTGCACAAAAC
TAGCCACAAGACATACAAGGGACTTAGTCTCAAACAGGGCGAGAAGTTCGATTCCTTCGAAGAGGTAGGCTTCGTTGTAC
CTCCTCTGCGTCGACTGGACTAAGACTTATCCTTAACAGATCGACAGCGACGTCATCGTCGACTTTCAGCTGGCCTACCA
GAACAGCGAGCCAAAAATTGATACGCCCCAGTTCGAAGAATTTCCCACGTATCCAGAGGACGAGGCACGTAGGCGCCAGC
AGATTTCTGACGACGAGGTAGATATAATGGTGCGGTTCCCAGTTCCCATAGAACGGCAATCATATGAGGAGAACAACTTT
GGGGATCGGCGCTGGATCGAGTTCAGAAACCGCATAGCTCATCTCGCCGAGAAGCGCTTGCCTGGGACTCTCGACGATGA
TTGTCTTCTGCTTCTGCCAGGCAGAGTGTATGGATACGTATTGCTTAATCGCAAGTGGTGTAGGTTTCACGCATTCCATG
CTTCCATTCCAATGGTGCTCTCCTTTTTCTGACCTTGTAGTGCCTCTGGACGTGAATCTCATTGGGGATGTCGTGAAGAT
ACGTCAAGGCGAGAACGACGGTTTCCAGAAGCTCATCCTGCCACGTGGCCACAAGAACATTGTTCGTGCCCTGGTCAGTA
CGCATGCTGCCCGACAGGCAGCTGCCCATGGCAGGTCCGGCTCGGACCCTTCCGGACACGACTTCGATGTGGTCAAGGGC
AAAGGCAAGGGCGTCGTCATTCTGTTGCACGGGGCTCCGGGCGTTGGAAAGACATCGACGGCCGAGTGCGTTGCACAAAC
GGTCGGCTGTCCACTTCTGCCCATCACCTGCGGCGACCTCGGGGCGACGACGGCCGGCGAGGTGGAGAAGAATCTCGAGT
CATTCTTTGAGCTCGCCCGGAAGTGGGGATGCGTCCTGCTTCTTGACGAGGCTGACGTCTTTCTTGCTGCACGGGAAAAA
GGTGATATCCGGCAGACTAGTCTTGTGTCTGGTAAGTTTAGGTTTTATATGCTTTTGTTTTTCTTTTCCTATTGTCTACA
GCTTCCTTCAGCCTAACTCCTGCAGTCTTCCTCCGCGTCATGGAATATTACCCAGGCATCCTGATCCTGACGACCAACCG
GGTCGGCTCGTTCGACGAGGCTATCAAGTCGCGTGTCCACTGCGCGCTGTACTATCCTCCCCTGACCGAAGACCAGAGCC
TGAAGATCTGGAAAATGAATCTCGACAAGCTCGAAAAGAATAATTCGAGCTCCGATCCGGCCTTGAAGGTGCGTTTCAGC
CGCAAGGAGATCGAGAAGTTTGCCCAAAAACATTGGGACACCAGCGATGAAGGCACCCGGTGGAACGGCCGGCAGATCAG
GAACGCATTCCAGACAGCCGTAGCATTGGCTGAGTGGGACCACCTCCAAGAGTCACCTGGCGGAATTCGGCATCCCGACG
GACCCCAGCTCAACAAGTCCCATTTCAGAACTGTCGCCAAGGCTAGCCGCCATTTCGACGACTACCTCACCAGGGTGCGC
GGTACAGACGAGCATTGGGTCAGGACTCACCAGACTCGCTTTGACGGTTTTCCTGCATCGGAAGACTTGCGGACAGAAAC
GGCAAGGAAGACAAACAAGCCGGACAAGCCCAAACCAAAGTCCAAGGCTAAATCCAGATCGAAGTACACGTCAAAATCTA
GCAACAGGCGCCCACCTTCAAACTCGCCAGATATGAGCTCCGACAGCAGTGAAGATGAGGACAGTGGGGTCGACGACAAA
GCTGATGACAGCGTGGAGAGTGAAAGCGAGAGCGAGAGCGAGAGCGAGAGCGAGAGCGAGAGCAACAGTGAGGAGCCCAC
GCCTCCACCGACCAAGGGCAAGAAGAAGAAGAAAGACACAAAGAAGAAGAGCCGGGGAGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62