GenePrediction:GLEAN_2042 Details

Name: GLEAN_2042
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:301903..305994 (+ strand)
Length: 4092
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:301903..302691 (+ strand)
Length: 789
Type: CDS
Source: GLEAN
Position: GCSC_108:302746..305994 (+ strand)
Length: 3249
>GLEAN_2042 class=GenePrediction position=GCSC_108:301903..305994 (+ strand)
ATGAACACGAACATGTCTTCCAAAGAAACTTCTTCGGGTAGCACACCCACACAGAAAGGTGTTCGTCTCACGCAAGTCGA
ACTCCATCGGGACGATACAAACACAGACATCGACATCATCGCCATACATGGTCTCGACACGACGTCGAGAGACACATGGA
CATGGAGAGATTCCAAAGATCTCAAGAACGAAGCCAAGTGGGTCAATTGGCTACACCCAGGCATGCTTCCAGACCAGGTA
GCTCGGGTCCGGATCTTTACATGCGACTGGCCTGCCGATCTTCATCAGCCGAGAGACATGGTTCCAAAGGCCCTCGACGA
GTGTTCTCGGAGCCTGCTCGAAGGTATCCACGTGGAGCTCTATAAAGACAATGCAAGACGCGACAGGCCGATTGTCTTTA
TCGCGTCATGTTTCGGGGGTATCATCTTAGCGAGGGCTCTAGTGCTGGCAGATTTCAAAGACAGCAATTATCATCAATTC
AGAATTGCCGTGCGTGGCATCGTCTTCCTTTCAACGCCGTTCCGAGGGACTTCCTTCCAAGACATCGCTGCTTGGGCAGA
GCCGGGTCTCCGGGTTCGGGCTTTCTTGAAAGGCAAAGCATTGAGCAAGCTGCTTGGGAGTGTAAAGGGACCAACCTTTG
ATCTCCAGGAACTCGTCCGCTCCTTCACTCGGCTCTGCCAAGACGAGGAACACCCCTGCAACGTTTTCACCTTTTCCGAG
CAGAAGGTGACGAGCCTGCCACACAAAGCATTTCCTTGGCTGCCACCTCTGTTCCGCCAAAATAAGCCTGTAAGCATCAC
AAACGCCAATTCTTGCTTCTTCAAACGACTAATGCTTGTTCAGCTCGTCGGTGATTTCGAGGGAACTCTTGACATCGTTC
GTGAACCGACGTCCCTCGATCGATCCCACCTCTTGATGAACAAATTCCACAGCCCTGAATGTCCTGATTATAAGAAAGTC
GCCGGAAAGATAAGCGAGATTGTCGAAAAGATTCGTGTGGGAAGCCCACTTGAAAGGGCCGACGCCTGGATACGGGACAA
GCACTATACCGGGAACAGGCTGAAGATCGAACGCCTCTCCGGCGAGTTACTGTTGATGGATCGGTGCTACATCAATCTTT
CTATTGTGGAAATGTCTGAACAAGAAGCAGGTCGCCCAAAGGAAGAAAAGGCATCCCCGTTCTCAATGTGGTCTCGACGG
TGGGTCTCGACATCCAGTGAGACGACTCAAGTGGAGCTGGCGACACTCTTTGACTTACGGAAGGGACGCGAGGGCCAGCC
AATAAAACCAAGAAAAATACTGATTCGAGGGCGGGCGGGAGTTGGGAAGACCACCTTGTGCAAGAAAATTATTTTTGAAT
TCACCCAAGGCACATGGGCAGGATGGAGCAAGTTGTTTGACCGCATACTTTGGGTACCTCTGCGCAATCTGAAACTGGAC
GAAAGACGTCGTTCGCCGAAATACAACCTGGAAGATCTCTTCAACCACGAATATTTCTCTCTCCCAAAGGACATGCCGGA
GCTCGCAAAAGCATTGTACGAGGCAGTGGAGACCAAGAGCGATAGAACTCTGTTTCTCCTCGACGGCCTGGACGAAGTAT
CTCAAGACTTGACAGGCGATGCCGCCATGTCCCGTTTTCTCAACACTCTTTTGAAACAGCCCAACGTTATCATCACGTCC
CGCCCGTCTGGAACCCTTCCGGCCGACATACCTATTGACCTCGAGCTGGAAACTATGGGATTCTACCCAGATCAGGTAAA
GGACTATATCGAAAGAGCTTTCAGCGATTCAACGGGCAACATTGATTGTCAAAAGACCAACGAGGTTCAATCATTTATCA
AAGGCCATTGGCTCATCGGGGGACTCGTGCAGGTCCCAATTCAACTTGACGCGCTATGCTACACCTGGGACGACCTGGAC
CAGGGCACGGCACCAGATACAATGACTGGCATGTACAAAGCGATCGAGCTGAATTTATGGAAAAAGGACGCCGTGCGGAT
GAGCAAAAAACACAACGAGGAATTCGTGACATCTTCCCAGATTGGATCTTCAGACGTCGAGGCCATTGTCGAACATGAGA
TTTGCTTCCTTGAAAATCTTGCTTTCAATGGACTGGTGAACGAACTCATCGAATTTTCAGAACAATATCTTAAGTCCATG
CCAAAGATGTCCAGGGAGACAATATTACTCAGGAAGACACTACCATGCCTCTCCTTTCTCCGGACTTCTGACGCTAGAAA
CCGAAGTTACCACTTCATACACCTCACCTTTCAAGAATACTTTGCGGCGCGGTATTTTGTGCGACAATGGCGTACCGGAA
AATCTCTGGAATACCTGTCTCTCGACAGTCAAACACACGTGGATACATATCCTGTCAAGTTCCTCCAGACGCACAAGTAC
ACAGCACAATACGAAATCATGTGGCGATTTGTTACTGGCTTACTTGACGCAACCAGCCATGAAAAGCAGTTCCTCGACAT
GTTGGACCAGGAACCACTCGACCTGTTAGGTCCTGCACATCAGCGACTAGTCATGCAATGCCTGAGTGAGGTTTCGAGAA
ACTCTACAAGCAGGCCGGGCCTGGAACAGCGGCTGGCCAAGTGGTTTCTATTCGAAAGCAAAGTCTACAAGAACGAACGT
CTAGCAAGAGAAGTAGAGGCTCCGGACGCAGCACTTGTAGCTGCTCTATCCCATGCATTAGACGAGGAGAAAGTGGTACT
TCTTGGTGCAATAAAAAGTCGGCAAACGATTACGCCGAATCTTGCTAAGCAGGTAGCTTGCCTTCTTAATAACGGAAATT
ATGAGCTGCAAAAAGCAGCCGCCGCTGTCCTAGAAGTTCAAGCAAAGACCGTGGCGACGGTGCGAGAAAACGCAGATTTA
GGCGTCCAACAGGCCGCCGACAACGCCGCCGAATTCATCCCTAATAACCTGTCAAGGAAAGAAAATCTCGAGGCTTTGGC
AGCGAATATTAATAATGCAGATGCGGGTGTGCGAAGTGCCGCTTTTCGTGCCTTGGGTGATCAGGCAAGCTTACCAGAAA
GGATGCTTGAAGCTGTGGCGGCAAAGCTTGAAGATGCAGATGCAGATGTGCGCGAGGTTGTTATACAGGTTTTAGGTGAG
CAGGCGAGCTTACCAGAAAGGATGCTTGAAGCTGTAGCGGCAAAGCTTAAAGATGCGAATGCACATGTGCTCTACGCCGC
TGTAATGGCCTTAGAGAAGCAGGCGAGCTTATCGGAAAGGATGCTTGAAGCTGTGGCGGCGAAGCTTGAAGATGAAGATG
CATATGTGCGACGGGGCGCTGTAAGGACCTTAGGTAATCAGGCGAGTTTACCGGAAAGGATGCTTGAAGCTGTGGCGGCA
AAGCTTAAAGATGCGGATGTATATGTGCAACAGAGCGCTGTAAAGACCTTAGGTAAGCAGGCGAGCTTGCCAAAAAGGAT
GCTTGAAGCTGTGGCGACGAAGCTTGAAGGTGCGGAAGCATATGTGCGAAGTGCCGCTATTCGTGCCTTGGGCGAGCAGA
CAAGCTTACCGGAAAAGATGCTTGAAGCTGTGGCGGCGAAGCTTGAAGATGCGGATGCATATGTGCAACGGGTCGCTATA
TTGGCCTTAGGTAAGCAGGCGAGCTTACCGGAAAGGATGCTTGAAGCTATGGCGACGTTTCTTGAAGACGACAGCGGGGT
AACGCGACGGGAGGCCGAGGGAGCATTGCGACGACATGAAAGCTTTTATCGCAACCTCTTTGGCGGACCCTACGCCGTAT
CGCTATACAATTTATTTTTACAAATGAGCTTCTATGAACGACAAGTTTGGTATATTGATGACGGCCATCTTTGTGTCAAC
ACGCCAGAGAAGACTTTGAGGATCCCAGATCGCAATCAGCAAGGTGGCTTTAAGGCCTGGATCAACGAGGTGCGGCCAAA
AGGATTGCCACCAATAGGCGGAGGAAGTAGTGAGCTCGGATGTTCTTCTGAGATCCTTGAACAACGAGCTTTATGTACAC
AGATGAAATACGATGCATTTGCTCCTACACCACCTTTCAAATGCGACCTGCTATCACTGTACATGTATATAGTCCAAGAT
TTTCATAGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62