GenePrediction:GLEAN_2043 Details

Name: GLEAN_2043
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:310116..312256 (+ strand)
Length: 2141
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:310116..310339 (+ strand)
Length: 224
Type: CDS
Source: GLEAN
Position: GCSC_108:310436..310661 (+ strand)
Length: 226
Type: CDS
Source: GLEAN
Position: GCSC_108:310755..311684 (+ strand)
Length: 930
Type: CDS
Source: GLEAN
Position: GCSC_108:311777..312256 (+ strand)
Length: 480
>GLEAN_2043 class=GenePrediction position=GCSC_108:310116..312256 (+ strand)
ATGGGCGAAGTCGAAGATCTCCAGCTTAAGATCGCCAAGCTTCAACGTGAAAAGCAAGAAGCCCATGATGTCATCTTAGG
CCTCCAAAAGGAGAAGGAGGAAAACACGCGCATGCGAACCATCAAGATACCAAAGGACATACACGACACATCCTGCTTGC
TAACCCTGACCCGCCTTGTCTGGTCTGGCGTCCACTCACTAATCACACCTAGATCAAGCGCTAGGTGACTACCTCGCCAG
CATACATCGCGTCACCTTCCACATGAAAGGCCTTGTCCCAGCTCCCCGAACAATTGCTATACCCCAGACGCTCTCCGAAG
GTTCAAAGTCCTCGGCAACGACGTCCGGCCGCACCAGCATCGTCGGCAAGTTTTATCCGCAATAGAAGAGCTTCCCAGCG
AATTTCTAGGCTCTGAAAAATTCCTCAATGAAGCCAAGACATCATACTTTCTGCATGAGACGCTGCAGAAGCCAACTCAA
CGAATTCTCAACGCGTATCTGCGAGCCATCAAGTGTCCCAAGAAGCTCTATTTCGACAAGCGCACCGTCGGATGACGACC
TCCGCCGAGCGACTTAGCCAACGCGGTTGAGGGAGCTGATGCCGCACCCGTAGTAGTCCCCGCCCGACCGCCACCAAAGA
CTCAGCCTGACTGCCTCGTGCTTTGTGCGGACATCCTCACCAGCGCAGCCGAATTGGAAGCAGCTGCCGAGACGGAACAG
GCAGAGCAAGGCGTCGACTGTTTTGCTGACCAGGGCGACGACGTGGCCGCCGAGCCAGCCAGCACAGTCCACCATGTCCA
TCGCATCTCCATCGCCGAGCACAAGGCCGTACATCGTCTACGCGCCGCGGCCGTTGCACGCTACGCCCGTGGGACAATTT
CCGAAGATTTTATCGGCCAGCTGGCCCAGATTGCACGGTCAGCCACGGCCTCGGCGGCGACGACTACCACGGGTACAGCA
GCAGAGCCGCAGGACGCAAACGCCATAGCGATGGTACAAGAAGACGCGGTGCGCCAGGCAGAGCGTGGCCCACCTGGGCA
GGTCTTCTTTGCGCGAGCCTTGACCCAGGCCTTTCACTATATGGTGGCCTCGGGTCTCGAATACGGCTACATGGCCACCG
GCGAGACGCCCTCCCTCTTACGAGTGCCGAAAGACGACCGGACAACACTCCTGTACCACACCGCTCTTTTTCCTCTGTAT
ACCCGGCTGCAACTCGGTGCGGATGGCCAAATCGCGGCCGAATCGGACACTACTTTGCCACCCTCGCCAGCACTAACCGG
TGCCAATGTGGACGCCACCCAGCTTGCCGTGTCTCTGCTTACAGCTCTCAGCCTGCTAGCGTTTGAGTCGCAACCAGAGC
CGGTGCGCCAACGAAGCATCAACATTTCACAGCTAACACGCTTTCCCAATGCCCCCAAAACGATTGCCCCTCAACCGACC
AGCCGACAGAGCGGTCGCAAGCGGCGAAACGATGACGATGATGATGGCCGCGGCAGTGATGATGGCAATGACAACGACAG
CGCCGTGGGAGACATGTGCAGCCAGAAACGGTACTACAAACGACAACGGGTAGGACGACAGTACACAACATTGTAGGTCC
GACGCAGCCAAGTTCGCTAGACCCGTCGACGTTCCGCCCGATTCGGCCCTACTGCTCGCAGGCATGTCTTTTAGGCCTCA
TGCGGGGCAGCGAGCTGGATGTCAAGTGTCCCAACCTAATCCTGCACCGGCAGGCGCTGCAGCGTGATGGTACGGACCTG
CGCACGCGGCCGACGGCACATGCGATCACGGCGACTGAGCTGCACGAGCTCGTACGCCTGCAGCTGCTGGCCAACGCCGA
GCAGGACTGCCACTGCTTCCTCGAGCAGGGACTGAGCGGTGCCATCGGCTGTCTCTTCAAGATCACCATCACGGGCTACG
GCTACACCTTTTCCGCCAAGGGTGTCGAGGAACACTTTAGCGGCCGTCTGCGTCGCGAGGTGCGTGTCTATGATGCTCTG
GCGCCGCAGCAGGGAAGCTCCCTGCCAGTGTGTCTCGGTCTTGTGGAGCTGCTGCTACCGTGGCCTATGGCTAACGGTGC
GCTGGTCACGCACATGCTGCTCATGTCATACGCCGGACGGCCGCTTTTAACACCGGCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62