GenePrediction:GLEAN_2045 Details

Name: GLEAN_2045
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:350917..352841 (+ strand)
Length: 1925
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:350917..350991 (+ strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_108:351057..352570 (+ strand)
Length: 1514
Type: CDS
Source: GLEAN
Position: GCSC_108:352775..352841 (+ strand)
Length: 67
>GLEAN_2045 class=GenePrediction position=GCSC_108:350917..352841 (+ strand)
ATGATGCAGACTACGGGTGCCGCGACCAGCGACATTTTCGAGACGGGGGGCGTGCGTGTTGCCATCGAGGGATGTGTGAG
TAAGCCGGCCCGGTCGGAGGCCGACAGACGGCGTGCTGACCAGAGTCTGACATGTTCCAGGGCCATGGCACGCTTGATGC
CATCTACGCGTCGGTGGAGCGATCGTGCACAGAGCGCGGGTGGGACGGCGTGGACTTGCTGATCATCGGGGGCGACTTTC
AGGCGACGCGCAATGCGGCCGACCTAACGGTGATGTCGGTGCCGGCCAAGTTCCGGGAAATGGGGGACTTCCACGCCTAT
TACGGCGGCACGCGGACGGCGCCGTATCTGACGGTGTTTGTGGGTGGTAACCACGAGGCGGCCGCGCATCTTTGGGAGCT
CTTCTACGGCGGCTGGGTGGCACCCAACATCTACTACATGGGCGCAGCCAACGTGCTGCGGTTGGGGCCGTTGCGGCTGG
CCGGCCTCAGCGGTATCTGGAAGGGCTTCGACTACCGGCGGCCACACCATGAGCGCCTGCCCTTCAACCAGGACGACGTC
AAGAGTTTCTATCATGTGCGCCAGATCGACGTGCGCCGCCTGCTGCAGGTGTGCGAGCCCGTCGACATCGGCATCAGCCA
CGACTGGCCGCGCGGCATCGAGCGCCACGGCGATCACGCCCGTCTATTCCGCCAGAAGCCCATGTTCCGCAGCGAGTCCG
AGGAGGGCTCACTCGGCAGCGTGGCCGCCGAGCACGTCATGGACCGTCTCCGGCCGCGCTACTGGTTTTCCGCCCACCTG
CACTGCAAGTATGCCGCCATCAAGCAGTACGCCCCACCCGACAAAGTGCTGCCGGCTGTCGACCTGGCAAGCAGCAGGAC
GGCCATCGCTGCAGAACCCGTGGCTGCAGCAGCAGTCGACAATCCGGACGAGATCGACCTCGACCTCGACGACGACGGCG
ACGATGCCAGTGCCGGAGCCAGCAGCAGCAAGCCTGTCGAAACAGCACCCCAGATTGCGCAGACCAGCGTGCTCGGCATC
CCGGACGACGTGCTCGCACAGCTGCCCGCTTCGTTCCAGCGCTTGCCATCGGCACGGCCGCCGCAGCCAGGCCAGCCAGT
GCCGCCCACCATCACGAACACGACGGTACGCTTCCTCGCGCTCGACAAGTGCTTGCCGGGCCGCCACTATCTGCAGGTGT
GCGAGATCCCACCGGCCAGCACAGAGGCTGCCGCTGCAGCCGCAGCCGTAGCACCCACGAGCCATCCGGGCCGCTACCGG
CTCGAGTACGACCCCGAGTGGCTGGCCATCACGCGTGTCTTTGCGAACGAGCTCGTCATCGGCGCCGGCGCCGCGTCACC
GCCTACACCCAACGACCGTGGCGAGCTCCAGTACCGGAAGCTCATCGACGAGGAGCGCCGCTGGGTCGATGAACATATTG
TCGCCAAGGACCGACTGGCCGTGCCGGCCAACTTCGTGCTGACGGCGCCCGTGCACACGCCCGTTCCTGGCCGACCGGAC
ACGCACGCCAGCGGCCAGCCGGTAGAGTATACCAACCCGCAGACGGCGGCGTTCTGTGCGCTCGTCGGCGTGCCGAACCT
CTGGGACGCACCTGAAGCGGAACGGGAGGAGCGCCGGCTGCGTGGACCGGCGCCGTCTGAACATCCGTTTCATCAGCGCC
GAGGTGGTGGCGGCGGCGGTGGCAGAGGCAGAAGGGGCTTCCACAACGGTGGCGGAGGCGGCGGTCAGTGGAGAGGAGGT
CGCGGACGTGGACGCGGTCGCGGTTGGTGATGAACATGTCTACGACGGACGGATCTCAACGACATGGAAAAAACAAGGGC
ATATTTTTGTTATTTTAGGCGACGCCTCGACAAAGGCACAAGGTCCAAAAGATACTACGGCGCAGGCAGCTCGGAGTTGT
CTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62