GenePrediction:GLEAN_2046 Details

Name: GLEAN_2046
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:354691..355713 (+ strand)
Length: 1023
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:354691..354975 (+ strand)
Length: 285
Type: CDS
Source: GLEAN
Position: GCSC_108:355055..355258 (+ strand)
Length: 204
Type: CDS
Source: GLEAN
Position: GCSC_108:355312..355713 (+ strand)
Length: 402
>GLEAN_2046 class=GenePrediction position=GCSC_108:354691..355713 (+ strand)
ATGGCCACCCAGTACCGCAACTCTCAGTACAGCCAGCCTCCCACTCACGAACAATACGACGGCAACCAGCGACAGCCCAC
CAACAGCCGCCGCGGAACGCGGGCCGCCCGCTCAAGCGAAGGCACCGTCGTCAGCACAGTCTCATCCGCCTCGTCCGGCC
GCGAATCGTCCGGCACAGCCATGACCGAGCCACCCTCTTTCTCCAAGAAAATCGTCGTCGTCGGCGACGGCGGCTGCGGC
AAGACCTGTCTGCTGATCAGCTACAGCCAGGGCTACTTTCCAGAGGTAAGACGGCCAGCCCCTCGGCACGCTCGGCTCGG
CTCGGCTCTGCGCAGTCTCGCTTGCTAACCACAGCCATCCTCAGAAATACGTCCCCACCGTCTTCGAGAACTACATCACC
TATCCAACACACCCACCTACGGGCAAGACTGTTGAGCTCGCTCTCTGGGATACGGCTGGCCAAGAGGAGTACGACCGGCT
GCGGCCACTGTCATACCCGGAGACAGACCTGATCTTTGTCTGCTTTGCCATCGACTGCCCGAACTCGCTTGAAAATGTCA
TGGACAAAGTAAGCTACCCTCTTCGCTCATCGTGTCTGTTTATCGCTTCTGACTTTACCAGTGGTACCCCGAGGTCCTCC
ATTTCTGCCCATACACGCCGCTCGTCCTCGTCGGGCTCAAGTCCGATCTCCGCAACAAAAAGGCATGCATCGATATGCTC
AAGACCCAGGGCTTAACACCTGTCACTGCCGATCAGGGCATGGTCGTCGCCAAGAAGATGGGTGCTCAGTACATGGAGTG
CAGCAGCAAGGAAATGAAGGGGGTGGACGAGATCTTTGAGCAGGCAATCCTCACCGTTGTCTCAAACGACCGCAAGAACC
AGGAAGTGCAGGCTGCCAGTGTCAGTGGAAAGGGCTCCAGCAGTGTCGGTGTCTCCTTCAGCAGCGGCGGCGGCAGCAAA
GGCTCGAAACCAGTTGCGGCTACCCCCATGAAGCGGAAGAAGAGGCGGTGCATTCCTTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62