GenePrediction:GLEAN_2049 Details

Name: GLEAN_2049
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:373717..377051 (+ strand)
Length: 3335
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:373717..373777 (+ strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_108:373865..374234 (+ strand)
Length: 370
Type: CDS
Source: GLEAN
Position: GCSC_108:374303..376758 (+ strand)
Length: 2456
Type: CDS
Source: GLEAN
Position: GCSC_108:376822..377051 (+ strand)
Length: 230
>GLEAN_2049 class=GenePrediction position=GCSC_108:373717..377051 (+ strand)
ATGTCCTTTCAACGAAAGGATGGAAGCAACTCCGCCAAAGGAGATGGAAAGACACAGAATGGTAAGCAATGCCCTAGACC
GTTTACATATGTTGGGCTATTGGGCATACAGGTGAAAATTTGCTGACAAGCGATGTTTGTCCCAACAGGTACCCGTTCTG
GATTCCGGACAGACACTGCTATTTCAAACAGCCGCCCTGGAAACGAGCGTGTTCTCAAGCGGTGGGTGCCCGAAGCTCCC
GGAGATCTCGATGGACCTCTTGAGAGGGCGTCGTCGAGCAAAGGGGACTGGGATCAATTTGCGGTGAACGAACGTCTGTT
TGGTCTTAAGACAGATTACGACGAGAACTTTTACACTACCGCAATCGACAAGAACCACCCTAAGTACAACGAGCGCCTGG
CTTCCGCCGACAGGAAGGCTCGAGAGATAGAGAAGTCTGCTCCTACCACCAGCCACGTTGCCGAAGAGCGCGTCATGGAT
TTTGGCGGGACCGATAATGGAGGCGACGAAGAGGACAAGTGAGTACCTGTTTTGCTCGTCCTAATCCAGCACGTCTCAAG
TACAATTGCTAACATACCCCCTTTAGATACAGTGGCGTTCGCCGACAACAAGACTTTCCTCCGCTTTCCTCCGGCCGCGA
CAACAAGTACACACCTCCCGCTCGGCGTGCCCCTACCGGCCACACCACGGTGGTTGGCGCTCCTGTCGACCCAGCCATCA
TCATGGCACAGGTCAAAGGAGGCCCGGGCCAGAGCAATAGAAAGCAATTGACCCCGAAGCCCGAGGACCAGAAAAAACTT
GTTTCCGGCGCGAGCCGGCCATCATCGGCTGTAGTGACACCGCTTGTCATGACTCCAGAGCCCAAGAACGATGCCGAGTT
CCCAACCTCGGATGCTAAGCAGCCCGAGGCGAAGATCGGCGGCTCGGGGCAGCCCGAACCTGCTCAACCGGTCCAGCCGA
CCAATGAAAAGAGCAAGCCAACTGCTACTGCTGGGTCATCGTCATCTTCTCTTCGTCCGGCTGCTGTACCTGGGCGAGCG
GCCTTTTCGCCTAATGCGAAGCCAGCCGCATCAGTCACTTCATCGGCAGTCAACAGCCCCGCGCCACCGAGCGCAGCAGA
CGGCGTAGAGAAGGCCTTGCTTAAGGACTTCAAAAATTTCGCATCACAGGAGCGCATTGCTACAGAGAAGGCTCGGCAGC
ACAAGATGAAGGCCGATGCTCAGGTCAAACTACAGGAGCTGAAGAAGTTTGCTACCAACTTCAAGCTGACGACACCGGTT
CCCAGCGATCTCATTTCGATTATTGCGAAGGATCCTGCCAAGCAGAAGCAAATTCAGGAGAAGGCTTTACAGAATGTCGA
GGAGATGGCTGCCAAGACCAAAGCCGAAGCTAAAGTGAAGGACTCGACAACGACTTCGCCTTCGGCCACTAGCAAGGCTT
CGAACACCCCACCGAACTCCAGCACAGGACCTGCTCCTGCTTCTAAGCCCGCGACAAACACGACTTCCGGGACCGCTCCG
TCAACTGCAGCTTCTGGCGCAGCCGTGGAGAAGCCAGCGCAGGCAAACAACCGGGCACACGGGCCTGTGCACGGCGGCTC
TCCGTCCGTGCCTGGTCGGCATCCAAACTCCCGTCCTCCATACATGCAACAAAATTATCGCCAGCAGTCACAGATGTATC
GTGGGGACCATCGTTCGGGTGGCCAGCACATGTCTCAGGGACCCAGCACGGGCCATCTTGCGGAGCGCCTTCGTAACAAC
ATGGACCAGACGCGGTACCCAAAGCAGCCAGCGCCTCATGCACACTACAACGCCATGGGTGATATGCGAGCCCCCCCTAC
AGGCCCGGCGAATTCGGTCGACCCCAACTACTCCCGTCGTATAAGTGCGGTCCCAACTGGTGCGCAGAAGCTCAACCCCA
CCACTCATGAGTTTAGACCGAGTCCATTTGCAGCATCGTTCAACCCGGCCGGTCCCAGCACCAGCTCTAGCCCTCAGTCG
GCCATCAACAACATGTCGGAATCAATCCATCCCAGCGGAGCGGCCTCAACAGCACCGACCATTGTGACAGCCTCGTCGCC
GCAGACATCTCCCAGGAGCCCGATTCGACGGAAGGTGAAGGCGGTTGATGCCAAGAAGTGCCAGATTCTGGACCACATCC
GCACGATTAAGCCTCCACAGGGCAGAAAGTGGGATGACAATGACGGCTTGCGGCCATCCTATGACACCCCCCCCACTTGG
CGACAGCCACAGGACGACGAGAAGGCAGACTCAACCATGCGACTGACTTACAAGGAGTACTTTGAGCGTGTAGCCTTTAC
GGCGGCTTCGATGGTGACGCCCATTGTTGGACATGCGCTGCCACACGGGATGCCGCAAATGGTTCCGCACCAAATGCCCT
ATCACCTCCAGCAGCACGGTGGCCACATGGCTCCACGGCCGTCGCATATGCCGCCAATGCCGATGCATGCAGGAGGCGGG
CCGCATGGACCAGCGCCGCACATGCCGTACAACGGCAATGATGATCACCGGATGATGCATTCGAACTCTGCACAGTCGTA
TGCCTCGCCTCGCATGACGCAGGTGCCGATGTACGCACAGCAGGTTGGTGGGACGCCGCAGATGGCATATAACCAGCCGG
TGATGCCGTTCATTCAGGGCACTCCACAGATGAATAACTTCCGCAACTACCCGAACAATCCACAGCAGTACATGCAACCG
CAGTCTGGTCCGATGATGTCGATGATGCAGCCTCAGCAGTTTGTGGCTGTTCCCGGAGGCATCTTGCCTCCGGGCCAACA
GATGCCGGGGTATCCGGGCCCCCATCCTTCATACATGCCGCCCCCCGGTGCCGCCGGTGCAGCTGGTGGAGTGCCGCCTC
CGCAAGGACTTGGGGCGAACGGTTACCCAAGCCCGCGGCCGGTCCCTGCGCCGATGATGGCCCAGCAAGGATCCCAGCAG
GGACAAGCACCAATGTACGGAATGAGCCCCAGCATGCAGTACCAGCAGCCTGCCTTTGGTCCCCAACACCCGGGACAAGG
TGGTAAGCTTCCAACTATTTCTTGAGATGTGCTTGTGGATGTCAGTGCTGACGTTTTAGCAAAAGGGCCCATGCGAGGCG
GCTATAACAATCCTGGCTCCCAACAATTTGGAACGAGCCCACAACAGATGCACCAGTATGGGCCACCTCATCGGAATGGC
AGCGGGAGCTACGGGGGCAAGAATTTTCAAAATCACGGGCACAACTCGCATCAAGGGCCGCCTCCCCACCATCTGCCGCC
ACCTTCTTCCGGACATCAGAGTCGTGCGGGCGGCGAGGGCGAGGAGACCAAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62