GenePrediction:GLEAN_204 Details

Name: GLEAN_204
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:211231..212017 (+ strand)
Length: 787
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:211231..211589 (+ strand)
Length: 359
Type: CDS
Source: GLEAN
Position: GCSC_167:211657..212017 (+ strand)
Length: 361
>GLEAN_204 class=GenePrediction position=GCSC_167:211231..212017 (+ strand)
ATGTCGAACATGCCCCCTGAAAGCACTGAAGAGAGCATTGCGGCTGCGACAGCCGACGAGGCTCTCGTCTTAACTCCACA
GGAGCAGGAGTCTCTAATCGAAAGTGTGTACAAGAACCAGGGCGGAGACCTGGTGGTGCGGATCGTGGAGGAGGTCGGCT
TAAATGACTTTGGCTTCGTAGTTATGCGGCTCGACTACGGCAACGAGGAAGACTGGGTGCGATGGAAGGACTCTTTTACG
GAGCACCTAGACCTGAGTCTGGCCAAGGCGGAAGGCGGCGAGAGGATCATGGACAATCTGCTTGTCAACTTTGTAGAAGA
CGAGGAATTAGACATGGCAGGATTCTGTGGTACAGCTTGGTACGTATCAACAAAGTCTGGTCAGAACTGTACACTGCAGA
AATATCAAGGAAACTAACCTCTACAGGTACTACGTCGCTATCCAGGAAGAAGGACTAGTGCAGCCTGGCCTAGACTCGAG
CATGTTTCTTGCTGTGGACAGGAACGCGATAGACTCTCTCTTATCACCTGTAACAGGCCAGGAGCCCTGGGTCTGGGCTG
TTGATAGGACGTCCTCGTTCGAGGTCGGCCAGCAGCCACCCCAGGGCGATCCTCCGTTATCTTTGGAGTATCCCGGATAC
TTTCGAATCGCAATCTCAGAGCTCGTTCCACAGCTGTGGCCGGTGTGCATGCTGCTGGAGGAAATGTGTGGTACGCAGCT
GTGGGAATCGCTCGTTGGCATTGGACTTAATTTTCTGGTGCCCGGCGTGTCTCACACTCTTGGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62