GenePrediction:GLEAN_2050 Details

Name: GLEAN_2050
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:384475..385066 (+ strand)
Length: 592
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:384475..384565 (+ strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_108:384633..385066 (+ strand)
Length: 434
>GLEAN_2050 class=GenePrediction position=GCSC_108:384475..385066 (+ strand)
ATGTCTGCGCCAGACGCGCCCGCACCGCCTGAAGTGCCCGCAGAAGCCAGCCAGTCGACCTCGCTGCTGGCCAAGCTCGA
TGCGTGGGGGTGTAAGTGCCGCGTTTCTGTTCTTTGTTTTTCGGTTGTCGGCCGTCTTCTGACGCTCTCCCGCTCCAGCC
TCGGCCATGCCGTCGATGGGCCTCGCCACGCTTGTGGCTGCCCTGCACACGCGCCCTGTCCAGCCGCTGCCGCTGCTCTT
TGCGCCCGCGCTGCTCTTTGCCGGCTACGTCAACGTGGCCGGCTATGCCGTCGATGCGGCCGGCATGAGCGCCGCCTGGA
GCGGGCTGTACGTGCTCCTGTCGCTGCGGCGGGGCCGCGGTGGTGGCGGCGTCGGACCCGGCCTGATCGCCCGCGCCTGG
ACACCGTCCTCACAGCGCACGTCCACGCGCCGCCTGCAGACACCGGCTCGTCGTGCTGTCAGCGCCGTTGCCGTGGGCCT
CGCATCCGTCAACTGTGTGGCCGGTACGGTCACATACAGCATCACGGGCGACCGGGCCGCTGAGGCCGAGGCGAGACGCG
AACGCGACCGCTGGGGCGCTGAGAAACAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62