GenePrediction:GLEAN_2055 Details

Name: GLEAN_2055
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:426012..428734 (+ strand)
Length: 2723
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:426012..426038 (+ strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_108:426121..426840 (+ strand)
Length: 720
Type: CDS
Source: GLEAN
Position: GCSC_108:426961..427732 (+ strand)
Length: 772
Type: CDS
Source: GLEAN
Position: GCSC_108:427765..428264 (+ strand)
Length: 500
Type: CDS
Source: GLEAN
Position: GCSC_108:428318..428734 (+ strand)
Length: 417
>GLEAN_2055 class=GenePrediction position=GCSC_108:426012..428734 (+ strand)
ATGACGTTTTATGCCCCTGGTCTCCCGGTACGTTCTTTTTGCACCACAGCATACATATGAACAGCTTTTTCGTCGATCAC
TACTGATCCTATTTTCTTCTTCTTTCTAGAGCGTGGCTGCAGCTACCACCGACCTCCTACCGTCTATTGGAAGCATCGGA
AACACATTGCTGATCCCATGGCGAGGCATCACAGCCCCGTCGGCGCCTTCGTCGTCCTCCCGGACAAATGTGGCTGCCAC
GGACGCGACTTCTGCGGTACCTGCATCCCCAACGACCGTCCGGCTGCCTGACTTTCTGGCCACGACTACCCTGCCGCGCA
GCTTCGCCTCGCCATTTGCCCACGGTCTCCAGCCCACCGACGCACGGTCCATCTTTGCCAACATGCCACAACCGTCGCTC
ATGGCAGCGAATCCGTTTCTGCATCTGATCTTTGCCGGCCGCGCTCTTGGTGGCGCGTCAAGACCGCAAGCCCGAACACT
CTCGACGACCGCCTCTGTGAACCGCCTCTTCTGGCCGGCCGGCCAGCGGCCGCGGTTCTACGGCGTGACCAGCACTTCAT
CACTCGCTGCCTACCGTACTGCCATCGCATCTAGCATCCGCTTCGCTTCTCCGCGACGGACCGTTACCTCTGGCAGCATC
TCTCGGAACCTCCTCGAAAATCGCGAAGCGGCTGCCAACCGGAATCCCTCGAGTGCCACCGCGCAGACTGCCTTCTACCA
GGTGCTGCTCAAGGCCAACATGCCCATGATTGTGATCGAACGCTACAACTCGGGTCGTTTTGCCGCCAACGAAGCTACGA
CAGAGGCTTACCACCGCGCCCTAGGCATGGTCAGTGCCGCGCCCACCGCAGCAGCAGCAGCAGCAGCGGCTGCTTACAAC
GACGGCACTGTGGCAGGCGGAGCAGGAAGCGGCATCGCGGCAAATAACACGCACCTGACGCCAGCACAGCTGCAGGCGGT
GGGACAGGCAATCGCGGCGCAGAACCGGGGTGCAACGGTGGCCGTGGGCAAGAGTGCTCAGGGTACCGGAGCTAAGGACG
CACCGATTCATGTGGTTGTGGACCAGCCCATCAGCGACGTGCTCTTCCGCTGGGTCAAGTTTGTTCTCTGGTTCTGTCTG
TTCACTTACTTCAGTCTGGTCGTGATCACGATGTTGATTGAGGGGCTCAACACGTTCAAGCGGCCGACAGGACGCGCGGA
CAACGAGGTCAAGGCCGAGAGCCAAAAGACGCGCTTCACGGACGTTCACGGCTGCGACGAGGCCAAGGACGAGCTGCAGG
AGCTGGTCGACTTTCTCAAGAACCCGGCCGGCTTTTCGACATTGGGCGGCAAGCTGCCCAAGGGCATCCTGTTGGTCGGT
CCTCCGGGCACGGGCAAGACACTTTTGGCTAGGGCGGTCGCCGGCGAGGCGGGCGTGCCGTTCTTCTACATGTCAGGCAG
CGAATTCGACGAGGTATACGTGGGCGTGGGCGCCAAGCGGGTGCGTGATCTGTTCACGGCCGCGCGGGGCAAGTCACCGG
CAATTGTATTCATCGACGAACTGGATGCCATCGGCAGCCGGCGCAACTCACGGGACGCGGCCTACGTAAAGCAGACGCTC
AACCAGCTGCTGACGGAGCTGGACGGATTCGAGCAGAACAGCGGCGTGATCATCCTGGCGGCGACCAACTTCCCGGAGCT
TTTGGACAAGGCACTGACGGGCGACCAGGCCGGTTCGACCGGTTGGTGCAGGTGGACCTGCCGGACGTGCGAGGACGGCT
GGCGATCCTACAGCACCACGCGCACAAGATCAAGTCGGCCAAGGATGTGGACCTGCAATCGATCGCGCTGCAGACGTCGG
GGCTGTCGGGAGCGGAGCTGGAGAGCATCGTGAACCAGGCGGCGATCCACGCGAGCAAAGCCAAGGCGCTGTCGGTGACC
AAGACGGACTTTGACTGGGCCAAGGACAAGGTGATCATGGGGGCTGAGCGCAAGAGCATGGTGATCAGCCCCAAGGAGAA
GGAGCTGACGGCGTACCACGAGGCGGGTCACGCGCTGGTCAGCTACTTCAGCCCGTCGTCGCCGAACAAGCTGTACAAGG
TGACGGTGCTGCCACGTGGTGGCTCGCTGGGCCACACGTCGATGCTGCCGGAGATGGACAAGTACTCGTACAGCGCCAAG
GATTTCCTAGCGATGATTGATGTTTCGCTGGGCGGGAAACTGGCCGAGGAGATCAAGTACGGCAACGAGATGGTGACGGG
CGGTGCATCAAGCGTGAGTGTTTGTGTTATGGGCATTTTGTTAGGAGCATCAACTAACACAACCAGGACCTGGAGCACGC
GACATCGATTGCTTACCGGATGGTGACGCAGCTGGGCATGTCGGAGAGGGTGGGCCCAGTGCAGATGTGGAACCGGTACG
ACAAGCTGAGCTCGGAGACCAAGGCGGTGATTGAGTCGGAGGTGCAGAAGACGCTCACGGACGCGTACGAGCGGTCACGA
CGGCTGCTGCAGTCCAAACGCAAGGAATTGGACCTGCTGGCGGCAGCACTGCTGCGGTACGAGACCCTGGACAAGGACGA
GGTGCTCAAGGTGATCTCGGGGCAGAAGCTGACGGGCCGTATTGCCGTGCCGGAGGGTCCGATGCTGGTGCCCAAGCCGG
CCAGCTTGGATGACGACGTGCCGTCTGACCTGGCCGACGAGGACACCAAAGCGCCACCGCCAGCGCAGCCGGAGGCTCCA
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62