GenePrediction:GLEAN_2056 Details

Name: GLEAN_2056
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:429300..430402 (+ strand)
Length: 1103
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:429300..429342 (+ strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_108:429402..430402 (+ strand)
Length: 1001
>GLEAN_2056 class=GenePrediction position=GCSC_108:429300..430402 (+ strand)
ATGACCAAGGTTTTGTTGACCGGTGGTTCCGGCTTCATTGCCAGTATGTGATCTGATCGTGCCGTCCTTGGCGCCGTTCT
TGTCTTGCTAACGCCAGGCCAGCCCACATTCTCGACCTGCTCCTGAAGACGGGTCACGCGGTGGTGACGACGGTACGGTC
GCCCGAGAAGGCGGCGCCGATCCACGCGGCGTACCCGGACGTGGGCCCGGAGCGGCTGCAGACGGTGATTGTGCCGGACA
TTGCGCAGGAGCAGGCCTTTGACGAGGCCGTACAGGTGCCGGGCATCGAAGTGGTGCTGCACACGGCGTCGCCCTTTCAC
TTCCGCGTGACGGACCTGAAGCGCGACCTGGTCGACCCGGCCGTCATCGGCACCACGGGCATCCTGCGGGCCATCGCAGC
CCACGCGCCGCAGGTTCGCCGCGTCGTCGTCACGTCGTCGTTTGCTGCCATCGCCGACGTCAGCAAGTCGGACGATCCGA
CCACCATCTTCACCGAGGCCTCCTGGAACCCGGTCACGCTCGCCGACGTCACCGGCGCCAACAACACCGTCGCCAATGCC
GGCACCGGATACCGTGCCTCCAAGACGCTCGCCGAACAGGCCGCCTGGGCCTTTGTCCGCTCCCAGAAGCCCAACTTCGA
CCTCGTCACCATCAACCCCCCCATGGTCTATGGTCCCGTGCTGCATCACGTGACTGGCGGCATCGCCGCCATCAACACCA
GCAGCGAGATCTTCCGCGACGTCATCACCGGCGCCTGGAAGGACAAGGACGAGCTGCCGCCCGTTCGCGTCGCCAACTTT
GTCGACGTCCGCGATGTCGCCACCGCCCACGTCGCCGCCGGCTTCCAGAAGGACCTCGGCGGCCATCGCCTCTTCACCAC
CAGCGGCCACTACGACAACCGCACCATCCTCGAGATCGTCCGCGCCCACTTTCCCGAGTACGCCGACGTGCTCCCGCCCA
AAGACATCCCCGGCGGCGACCTCCCTGCCGCTCACTACGGCTTCGATAACTCCGAGACCACCCGGCTGCTCGGCATCACC
TGGATCCCCCTCGAGAAGTCTGTCGTCGATGCTGTCAAGAGCATCCAGCCGCTGTTGCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62