GenePrediction:GLEAN_2058 Details

Name: GLEAN_2058
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:435115..438025 (+ strand)
Length: 2911
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:435115..435392 (+ strand)
Length: 278
Type: CDS
Source: GLEAN
Position: GCSC_108:435465..437311 (+ strand)
Length: 1847
Type: CDS
Source: GLEAN
Position: GCSC_108:437724..438025 (+ strand)
Length: 302
>GLEAN_2058 class=GenePrediction position=GCSC_108:435115..438025 (+ strand)
ATGGCCGCTCCGCAGGCTGTGTTGTCGCGGAAGTTCAACGGGGTTCTTCCGGTTCCTGCCAGCGCCACAGCAGTATCGAC
CGTTCCGAGGGCAGCGGCTGCCGATGCCACCAAGCCAGTAAAGGCGAAGACGGCCGTAGAGGGTGACAAGTTTGTCATTC
GCCGGCTTCCGCCCGGCCTGACCGAGGACGAGTTCTTCACCATCCTCGGCGACGAGTGGAAGCAGGGTCGTGGACGAGTC
GGCTGGCTGTCCTTCCACGCCGGCAAGATCTCGAAAGAGTAGGTTGCGCCTTGTGTGCCAGCAGTCCTTGGATGTTGTGG
CCTGGCCGGCTAACCCACGCTCTCCCGCAGCCCTTCCAAGCCGTCCCGGCCAGCATTTGCGGTCCTCCACGTGCTGCGCA
ACGAGGACCTGGGCCTGCTGTCGGACGTTGTACGCAGCGCATCGTGGGTCGACGCCAAGGAGTCGTGGACCAGCCCGGTA
TTGGTTGGGCCGCCCGTGGCGGAGTTCTCCCTGTACAAGAAGGTGCCGAGCGGCAAGCGTAGGACCGACAGCCGCCAGGG
GACGATCGACCAGGACGCCGAGTTCATGGCGTTCCTCGAGGCGCTGGCCAACCCGACCAGTGCCAAGGAGAGCGCTGCAG
CAGCGGCCAACGGCACCGACGGCGGCCAGACAGCGACGGCCACCAACGGTGCAGCAGGCGGTGCTCTGGGCGAGGACGAT
GCGGCCAAGACCAAGACCAAGGTCACGTCGACGCCACTGATTGACTTTCTGCGCGAGAAGAAGGCGAACAAGAGCAAGGA
GACGGCCAACGGGAAGTCCGGTAAACAGGGACGGGATAAGGGCCGAGGATCCGGCACTCTGGACGAGCCGGCCAGCTCCA
AGAAGCGGGCCAAAGGCGATAAGGTCGACAAGGCCGACAGGGACAAGGAACGGTCGGGCAGCGGCAGGTCCAAGGCGTCG
GTTAAGATCCTGACCAAGAAGGCCATTGCTGAAGCTGCCGAGGCAGCGAACAATCTGGCGGCAGCGGCAGCGGCATCGGC
AGCCGGAGGAGTGTCCGCATCGGCCTCGGGTACGGGCAAGGAAGAGATGCCCAAGAGTCGTCGCGCCGGCATCCTGGCGG
CTGCTCGGATTCTGCAGCGCGATCTGGGTCTCAGTCCGGGGCTGGCCCATAGGAAAGCCAGGGCAGCCGCCGCACAGGCT
GCACAGACTGTAGGCCAAGCGGACAGCGACGCGCCCAAGGTCAACGGAAAGACAAGAGAGAAGGACAGCAGCAGCGCTGT
GGCGGCGCCAGATGGGCATTCTCCCAAGACGGCCACAGGTCCTGCGGCAGCGACATCTGCGGCAGCAACAGCGACAGCCG
CCGGATCCAAGAGAACGACACGAGGCACAGACGAGAACGGTCCGTCGTCCCGTGGATCCCGTGGCAAGAAGGGCCAGGGC
GGCGACTCGGGTAGGGGCAAAGCTGCGACAGCAAACAAGGGAGAAGTCGGTGCGAGCACGCCTGCCAAGATCCTGTTGAA
GAAGCGGGAAGATAGCTCGTCGGGCGCGACGGCGACGACGACGACGACAGCAACAGCTACAGCGGCGACGAATGGAACTG
CGATGGCGATCCCTTCGGCAGGTCCCAAGGCCGGTGCAGAAAAGACCAAGTCCACGGGCACGAGGAGGGGAGGAGGAGGG
GGGACCACGGGAGGAGCAGGGGGCAATGGCAGTGGCGGTGCTTCGGCTACGACGACGACGACGACACCGACACCTGGTGC
AACACGGGCGTTTGTCAAGCACGCTAACCCGTCGCAGGGCGTGACGGAGGTGCTGCTCAAGGAGGCGATGCAGGTCTTTG
GCACGGTGACGCACGCAGAAATCGACCGGCGCAAGGGCTTTGCGTTTGTCGACTTTGCCGACCACAGCAGCCTGGTGCGA
GCGATGGAGGCCAGTCCTATCAGCGTGGCTCAGGCGGCCGTGCAGGTGCTCGAGCGCAAGGATCGTGAGCCGAAAAAGAG
CGGCGCCGCACAGGGATCGACAGCAGGCGTGGCAGCAGCAACGACTGCGACGGCCTCTACGAGCAATGCAGCGTCTGCCA
GTTCTGCTACTGCTGCTGCTACGCCGGCAGGCAAGCCGTCTGACAGCGTGGCCGGAGACAAGGCACCGTCTGTTGCCACC
ACAGCAGACGGAAAGCGGCCGGCCCGACGGCGAGGAGGTCGCAGACGGGGTGGTGGCGGTGGAGGCAGCAGTGGTGGTGC
GGATGGCGACGGTGGCGGTGGAAAAGAAGGCACCAACGCCGGCCGACGAGGAGCAGCAGCCTCTGGAGAGGGGGGAGGAG
GCGGTCCAGCGCCGACATCGGCTGCAGCGTCTGCTGCTGCTGCTGCTGCCGCTCCCAACAAGACGACCGGATGAAGGTGT
GCACCTTTTTTTCCTTTTTTGCCACATCTGCTGTTGCAAAGCCTGTCACGTCATCCGTCCCTCTCTCTCTCTGACCGCCA
GAAGGAGAAGGCGGCCTTGAAGCTTGGCCGTAGGGGGAATGAATGGATGGAGGGGTGGTGACATGCGTCCATTGTGCGTC
CAATGTGCGTCAATGTGCGTCGATGTGCGTCAATGTGCGTGATCTGCAGTGACGGGCAGAGTCGTGCGCACATGCGCGGG
AAAAGAGCGGAGAGGTCGGACAGCATGGAAGAAGAGGAGGGAAGAGGGGGGGGGTGTGTCCAGCGAGCTGAAAGCAGACG
GCTGGCGACAAGACGTGCGAAACGGCCAGAACGGCTCGAACGGCTCAGACGGTCGGCAACGCTGGCTACACCGCAACCGT
GCTCTCTCTCGATGGTGGATCGAACCAGACGACAGTGTCGCTGAACACGAGCACGAGCTGTGGTCGACAGGGCTGCTGCT
CGCTCGGCTCGAGGTGCGCAATAGCCGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62