GenePrediction:GLEAN_2059 Details

Name: GLEAN_2059
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:453093..454633 (+ strand)
Length: 1541
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:453093..453157 (+ strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_108:453217..454633 (+ strand)
Length: 1417
>GLEAN_2059 class=GenePrediction position=GCSC_108:453093..454633 (+ strand)
ATGGCCAATCTTTCGGTCAAGATCAAGACCCCCCTCACGGGCGAGCTGACGCTCCCTACGGGCCTGTGAGTTTCTGACGT
GTTCTGGGACGAGTATAGGAGACCATAGGAGGCTGACCGTGCAGGTTCATCAACAACGAGTTCGTGGCCAGTGTCGATGG
CAAGACGTTTGAGGTGGTCAACCCCTCGACAGAGGAGGTGATCTGCTCGGTGCAGGAGGGATCAGAGAAGGATGTGGACA
TTGCAGTCAAGGCGGCGCGCAAGGCATTCAACGGCGTGTGGCGCGATACGACGCCGCAGCAGCGTGGCATCTACATGCTG
AAGCTGGCCGACCTGGTGGAGGAGAACAGGGAGAAGCTGGCCGCGCTCGAGTCGCTGGATAACGGCAAGTCGATCACGCT
CGCACGCGGCGATGTGGATGCGGTGGCCGGCTGCATCCGCTACTATGGCGGCTGGGCCGACAAGATCGAGGGCAAGACGC
TCGACATTTCGCCCGACATGTTCCACTACACGCGCCAGGAGCCGCTGGGTGTCTGTGCCCAGATCATCCCGTGGAACTTC
CCGCTGCTGATGCTGGCCTGGAAGATCGGCCCCGCCCTAGCCACGGGCAACACGATCGTGCTCAAGACGGCCGAGCAGAC
GCCGCTTTCCGGCCTGCTGTTCGCTTCGCTCGTCAAGCAGTGCGGCCTGCCGGCCGGCGTGCTCAACATCATCTCCGGTC
TCGGCAAGGTGGCCGGTGCGGCCATGTCGTCGCACATGGACGTCGACAAGATCGCCTTTACTGGCTCCACGCCCGTCGGC
CGCGCCATCATGAAGGCGGCTGCGGCGTCCAACCTGAAGAAGGTGACGCTTGAGCTGGGCGGCAAGTCGCCCAACATCGT
CTTTGACGATGCCGACATTGAGAAGGCCATTGACTGGGTCAACTTTGGCATCTACTACAACCACGGCCAGACCTGCTGTG
CCGGCTCGCGCGTCTACGTCCAGGAGGGCATCTACGACAAGTTTGTCGCCGCCTTCAAGGCCCGCGCCGAGAAGAACAAG
GTTGGCGACCCGTTCCACGAGGAGACCTTCCAGGGCCCCCAGGTCAGCAAGCTGCAGTTCGACCGCGTCATGAGCTACAT
CAAGGCCGGCAAGGAGGAGGGTGCCAAGTGCGTCACCGGTGGCGGCCGTCACGGCGACAAGGGCTACTTCATCCAGCCGA
CCATCTTTAGCGACGTCCGCCAGGACATGAAGATCATGCAGGAGGAGATCTTTGGCCCCGTCTGCGCCATGGCCAAGTTC
AAGGACGTCGAGGAGGTCATCCAGCTCGGCAACGACTCCAACTACGGTCTCGCTGCTGCCGTTCACACCACAAATCTCAA
CACGGCCATCCGTGTCAGCAACATGCTGCACGCCGGCACCGTCTGGGTCAACTGCTACAACCAGCTTCACCACCAGGTGC
CCTTTGGTGGCTACAAGGAGTCTGGTATCGGCCGTGAGCTCGGCGAGCTGGCGCTGCTCAACTACACGCAGAACAAGTCG
GTTGCGATCAAGCTCCAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62