GenePrediction:GLEAN_205 Details

Name: GLEAN_205
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:221759..223180 (+ strand)
Length: 1422
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:221759..221791 (+ strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_167:221871..221877 (+ strand)
Length: 7
Type: CDS
Source: GLEAN
Position: GCSC_167:221951..222294 (+ strand)
Length: 344
Type: CDS
Source: GLEAN
Position: GCSC_167:222368..223180 (+ strand)
Length: 813
>GLEAN_205 class=GenePrediction position=GCSC_167:221759..223180 (+ strand)
ATGGCGATCCGCGAGGATCTCGTCGCTTCGGCGGTAAGTTTCCATCCAAGAGACGCCTGCCAGGGTTCTAGGGGCATAAC
CACTGCGTCGCGGTTGCTAACCGTTTCAATAGGCAAAATGTACGTTGACGTCCGACAACAACAGCAACAGCTCCCTGCAA
CAATTGGCAACAAACTGACCGCATGTGAACAGTCCTCCAAGACCCGAACGTGGCTTCGTCTCCGCCCGACAGCCGCGTGG
CCTTCCTCAAAGCGAAGAACTTGACACCCGAAGAGATTGGCGCAGCTCTCTCACGCGCCGGTCTCGACGGCGCCGCGCCT
TCGTATGCGGTTGCACCGCAACAACAGTCCGTGGCTCCTCAACACTCCCCCGTGGCACCGCCGCCATACTACGGCAGCCC
GTACGGACAACAACCATATCCGCCCTATGGATGGCAGCCGCCACCGCACGAGGCTCCGCGCCGCGACTGGCGCGACTGGT
TTATCATGGCCACCGTCGTGAGCGGTGTAGGCTACGGCCTGTACTCCTTGACCAAGGTGGGTGTTTGGATTGGCGGTCAG
GAAGACAAGGGTCCGTTGCTGGGACACGGCTGACGCGCGCGAATCACAGAGATACGTCTACCCGCTGGTGGCACCCCCAA
CGCCAGACCGGCTCGAGCAGGACAAGCAGGAGGTGAACGCGCAGTTTGAGCGGGCGTTTGCGCTGGTAGACCAGCTGGCC
AAGGACACGGAGGCGCTCAAAGCGGCCGAGCAGGAGCGCACAAGCCGCATCGATGAAGGCCTTACGATGCTGGAGACGGC
GCTGAGCGACCTCAAGGCAGCCGGCAAGCGGCGCGAGGATGACGCCGAGCGGCTGCGCGACGATGTCCGCAACCTCAAGG
ACGCGCTGCCTAAAGCGCTCGAGGCTCAGCGCGACGTCACCGACAATCGGCTGCGCGACGTCAACACCGAGCTCAAGGGC
CTCAAGACGCTTGTCGGCCAGCGCCTGGCCACAGCCGCGCCGACCCCGACGCCGGCACCATCGGCCGCCATCATCGGCGC
CGGTCCCGGCTTCAGCACCGTCACCAGCACGTACACGGCCGGAGCCAAGCCCGACACTGATGCCGCCATGTCCACGCCTA
CACCTGTTTCCGTTCCCGCACCCGCATCCGGCTTCATGGGCAACTACATGGCCTCTGACCTTACCACGCCGGCCAGCAGT
GGTCTTCCCGTCCCGACATCCCCCACAACGACGCCACCGCAGTCGAAATCCCCGCTCAGTGGCGCTGCCGGCAGGGCCTC
CATCCCCGAGTGGCAGCGTGCCATGATGAAGAAGTCGACAACCGGCACGAACGGCAATTCTGCTGCCACCACCAACGGCA
CCACCAATGGCACGGCCGCCGGTACCGCCAGCAGCGTGCACTCGGCCAGCAGCAGCTCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62