GenePrediction:GLEAN_2060 Details

Name: GLEAN_2060
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:456159..456658 (+ strand)
Length: 500
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:456159..456269 (+ strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_108:456328..456390 (+ strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_108:456452..456658 (+ strand)
Length: 207
>GLEAN_2060 class=GenePrediction position=GCSC_108:456159..456658 (+ strand)
ATGTCTGCCAACTCTCGAGCGCCGTCTGCCATGGGCGCGCGCAGTGCGGCTGCCGGCAAGCGATCGTACTTTGAGCAGCA
GCGCGAGATTCTCGTCGGCGAGATTGCCATGGTCAGTGGCGTCGGTTTTTGTCCGTGATGACGTCCGCTTGCTGACGACC
ACGTCGCAGTCCTTTGAGCATGTGCTCGCCAACATCAACAAGCTGAACCGCTCGCTCGAGGCCGTGATCACGGTGGGTGC
CGTGCCTTGTGTCCTGCCTGAAGGGGGGCTCCTTCGCTGACGCGTTCTCCCAGGTCGGCAACGAGTTCTCGTCCGTCGAG
GCGCTGTGGTCGCAGTTTGAGGGCGTCATGGCCAAGGAGGAGGACGCCACCGACAGCGCGGCTGCAGCTGTAGCCGCGGA
TATCGGCGAAGACGGGAGCGCGGAGGCGGATTACGCGCACACAGAGCTCGGAGGACAGGAGGACGAGGCCGGTGCCGCAG
GCTGGAAGGGCAGGAGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62