GenePrediction:GLEAN_2063 Details

Name: GLEAN_2063
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:485133..485720 (+ strand)
Length: 588
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:485133..485279 (+ strand)
Length: 147
Type: CDS
Source: GLEAN
Position: GCSC_108:485400..485604 (+ strand)
Length: 205
Type: CDS
Source: GLEAN
Position: GCSC_108:485683..485720 (+ strand)
Length: 38
>GLEAN_2063 class=GenePrediction position=GCSC_108:485133..485720 (+ strand)
ATGGAACGCGAGCATTGCCGACTCACGCCACCAGTCGGAGGAGGGCAAAAAGAGATCACGACGAAAAAAGAGCTGTTTCT
GCAGCTTCACACCACATCCACACCCCCGACACCAGAGACCATATTGCACCGTTACCGTCCGATCAAGGTTCGTACGACTC
CGGCTGCGGCCAATTGAGCAGATTGGCCGATGAAACGGCGCCATTTCCACGGGATCCGCCTTGGCTGACTGGATACGTTT
CCTTTCCTTCCTTTTCTCCTTCTGCAGATGTTCTCCCGCGCCGCCATTCGCAGCTCGCAGGCTGTTGCTGGCCGTCGTGC
CTTCCACGCCACGCCGGCCCGCCTCTCGTCGCCGTACCACTACCCCGAGGGCCCGTACTCCAACCTGCCGTTCAACCCGC
GGAAGAAGAGCTTTGGCCTGCTCTACTGGGGCGCGATGACCGTCGGCTTCTTTGCGCCATTTGGCATCTCCGGTGGGTGA
CAAGAAAGGGGATAGTCCGTGTCGGAGGCCGCCAATGCTAACAAGAATGACAGCCTACCAAACCTACAAGCCGAAATAAG
CGGCTCGCTCAAGCGGCTCGGTCTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62