GenePrediction:GLEAN_2064 Details

Name: GLEAN_2064
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:488432..489211 (+ strand)
Length: 780
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:488432..488808 (+ strand)
Length: 377
Type: CDS
Source: GLEAN
Position: GCSC_108:488866..489211 (+ strand)
Length: 346
>GLEAN_2064 class=GenePrediction position=GCSC_108:488432..489211 (+ strand)
ATGGGCCGCCAGTTCCGCGCCGCACGTGTCGCCCAGACCGTGCGGAAGGGCCTTGGGATTCCCCTCACGCCGCGCCTTCG
AGACACGGCGCCACCATGGCTGCACGTGGTCGAGACCATTCCGCCGGCCGAGATTCTGACCCGGACGATCCCTGTGGCGC
ATCATGCGCCCGATCCGCACATGCGCAAGCCACGGCGGACGTACCGGCCACAGCGCATCGTGTACGAGGAAGACGAGCTG
CGACAGACCTTCTTCCGCGATCATCCGTGGGAGCTGGCACGGCCGCGGGTTGTCGTCGAGATGGACGGCAAGGATGCACG
ACTGTACGACTGGAGCCGGGGGCTGGTCCAGCCAGGACTGCCTCTAGGGGGAGAGTGGTGAGTTTTTCTCGTTTTTTTTC
TGTCTGTCGCTGCTTTCGTCTTACACATGTCCAGCGTGGTCCAACGACAGCTCTGGATGATGCACAATGCCGGTATGACC
AAGGAGCAGGCCTACGATGCGGCCCGCCGCGAGTTTTATGCCCTGCGCCACCAGGAGGAGGTGGAGCGGCGTGTCGCCCA
GGAGGAGGCCCGCATGGTCGGCGCCTACTTTGGCAAGTCGGCCCTGCAGTTCGGCATGGACCTGGAGGACAACACGTACG
AGCGCTGGAAGACCTGGGCCGCCGGCGAGACGGCCAAGATTGAGGCTGAGCGCAGCCGTGCGTACGTGACGTTTGGCACC
GAGGCTGCCGAGGATGCCGACGCGGCCGAAGGCGATGCGAGCGCAAAGCAGGCCGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62