GenePrediction:GLEAN_2067 Details

Name: GLEAN_2067
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:504096..504960 (+ strand)
Length: 865
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:504096..504587 (+ strand)
Length: 492
Type: CDS
Source: GLEAN
Position: GCSC_108:504664..504960 (+ strand)
Length: 297
>GLEAN_2067 class=GenePrediction position=GCSC_108:504096..504960 (+ strand)
ATGGAAGCCAGCAAGAATGCTCTAAAGGACGAGGAGGCCAATTCGTTCATCGATTCAGATCATGAGCTAGATGACCATAT
GAACGGACACCAGAGACAGCAACGGCTTCTAGTATGGCTCTGGAATGCTACTCTTCTTGTCCTTGCGTCTGGTTGGATTA
TACCCCTTCTTCAACGACACAGCATTGTTGTTCACAAAAGCACAACCGCTGCAGACACTTGGGGACGGCCAGACAACACA
CCGCTGCCGCCAGAAGTGTTCCAAACAGTCAAGAAAACGTTTTTCCGTGATGAGCGCTATATTGGCACCACTGTGGAAGT
GCACCGAAATTGGGATCACATTGTTGCCGGTCACGATGCTCTGTACATCGAGAACCCTGAAGCCTATGGTCTGCCAAAAG
GGACTCATCCACCATTCGACCACCCTGGAAAGGTGGGAGAGGGCCCGCCTGTCTTCTATGTTGTCACTATCCTGCACGAA
ATGCATTGCCTGGTAAGCCGGCGCAGCCTACTCCGGATCTCTGCTTCATATTGCTGTCCCAGAACAGCGCTAACGAGACA
TTGAGAAGAACATCATCCGCTATCGGTACTGGGAAGTAAAGGGCAAGGCCTCACCGCTGCATGATTATTCAGACGCGGCG
TGGGATGCGCATATTGACCACTGTTTTGAGTATTTGAGGCAATCTATATCATGCGGCTCGGCCTTTCAAATTGAAGGTGC
CTCGCCTTTGAAAGTTCCGGGTGAGAAGGGCAAGGCTTCGACGGTAACGGGTTGGGGCACTGAACATAGCTGCATCAACT
TCGAAGCACTCAGGGCATTTCAAATCAACCAGGAACGACGCTATAATGCGACCTGGCACGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62