GenePrediction:GLEAN_2068 Details

Name: GLEAN_2068
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:507366..508461 (+ strand)
Length: 1096
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:507366..507371 (+ strand)
Length: 6
Type: CDS
Source: GLEAN
Position: GCSC_108:507459..508041 (+ strand)
Length: 583
Type: CDS
Source: GLEAN
Position: GCSC_108:508121..508461 (+ strand)
Length: 341
>GLEAN_2068 class=GenePrediction position=GCSC_108:507366..508461 (+ strand)
ATGAAGGTACAGATCTCTCTTGCCCCCCCTTCCGACGCATGTCTGCAGCTGCTCACATACCCTCTCTCTCTAGGACATTC
CCATTGCTGACAGGTACCGAGTGGATCGCAAGATTGGCGCCGGAGGCTGTGGCGCCGTGTAATCCGGTACGATGCCGTAT
CTCGCTGCTCCAGGCTGCTCCGGCCGTGGCTGACTCGAGCAGGAACCGATCTCCAAACGGGCGAGGAAGTCGCTATCAAG
CTCACATACATAGCAGATGGCCCCGAGATTCTTCGATGGGAGAAGCACATGTACGACGAGCTGGCTGGTGGGGCTGGAAT
TCCGCGCGTGAGGTTTTACGGTTCAGAATGCGACTTCTACGTCCTGGTGCATGATCTGCTCGGCCCTTCTCTCGAGGATC
TGTTCAACTATTGCGGCCGGAGATTCTCGCTTAAAACTATCCTCCTCATCGCCGACCAGGCCATCTTCCGTATTGAACAT
ATTCATGCCAAGGGCATCATCCATCGCGACATCAAGCCCGATCACTTTTTGATGGGGCTCGGCAAGCACGGGAACACGCT
CTACGCGATCGACTTTGGGCTGGCCAGGTGTTTCGCTGATTCCCACAAGGATGTGGAGGGTCTTCCGTTCGGCGGCACTC
GACTGTTCGCCAGCATCCGCAACCACGGCGGCTGTGGTAGGTGCTCTCTCTTGCCTTTTTTTTTGTCTCCTTTTCTCTCC
GAGTTTCAGTCAGTCGCTTGCTGACACGCGAGAAGTCCAGTCTTGGGGGGACGATCTGGAGTCGCTTGGGTATGTCCTGC
TGTATTTTGCGCGCGGCTCGCTGCCGTGGCAGCATTTGGAAATCTCAGGGAACAAGGCCGACGACAAGCAGATCAAGGCG
ATGAAAGAAAGCTTCTCGGGAGAAGCGCTCTACCACGACGACCTTCCCTCACCTTTTGCCACGTACATGGACTACGTACG
ATCCCTGGATTTTGGCGAGAAACCCGACTACGCATACCTTTGGGGCCTTTCCCGTCGCTTGTTTACTGCAGAGGGCTTCA
AATACGACAAAGTCTTTGACTGGACCGAGAAGAGGTTTCATGAGATCTGTAGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62