GenePrediction:GLEAN_2069 Details

Name: GLEAN_2069
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:509244..514257 (+ strand)
Length: 5014
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:509244..509459 (+ strand)
Length: 216
Type: CDS
Source: GLEAN
Position: GCSC_108:509540..510581 (+ strand)
Length: 1042
Type: CDS
Source: GLEAN
Position: GCSC_108:510682..510967 (+ strand)
Length: 286
Type: CDS
Source: GLEAN
Position: GCSC_108:511055..511655 (+ strand)
Length: 601
Type: CDS
Source: GLEAN
Position: GCSC_108:512071..512522 (+ strand)
Length: 452
Type: CDS
Source: GLEAN
Position: GCSC_108:512708..512758 (+ strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_108:512833..513039 (+ strand)
Length: 207
Type: CDS
Source: GLEAN
Position: GCSC_108:513096..513983 (+ strand)
Length: 888
Type: CDS
Source: GLEAN
Position: GCSC_108:514050..514257 (+ strand)
Length: 208
>GLEAN_2069 class=GenePrediction position=GCSC_108:509244..514257 (+ strand)
ATGGCCTGCCCAGCAGATTTCATGTTTGGCGCCATTTTATCCTTCGACGACCATTCGGTAACGTGCCGCAACTTCGACTT
CCGCATCATCTTCGAAGATGCCTTACTGGTATTGACACCCAGCTTGGCTCTTCTTCCCACTGTTGCCATGCGCTTTTTTT
CTATCGTTCGAAAACCCAAGATCGTGGTGTGGCAATGGATGCAGAAGCTCAAATTGGTTCGTGTTGTAGAGCTCATCTTT
CCTGTCTTATTAAGGCCGCTATTGCCACCCTCTCGTATCATCGCTGACCGTGGCAGGCACTCTATGCTATTTTTGGCATC
CTGCAGCTGGCAGAACTGGGCCTTTTCGCTTCTGGAAATGACTACACCAAGACAAGGCTCACCGTTCCCGCCTACGCCTC
CATGTTTGTTGCAACCGTCTGCCTTGCCCTCCTGTCTTCTCTAGAACACGGCTCATCTCTGCGACCATCTGTCGTCATTC
AGAGTTTCCTTTCTCTCACCCTCCTATTCAATGTCGCTCTCCTGCGTACTAGATGGCTTCTTCATGGCGAGCAAACATTG
GCGGCCCTGCTTAGCACCGCCTTTGCTCTCCAGTGCGCTCTTCTGGGCGTGGAATCTCTTCCCAAGAGCTCCCATATCCT
TCCGTCCAAGGCCGCAAGACTTTCTCCCGAAGAACGGGCTGGCTTTTTCAGCCGGAGCTTGTTCCTCTGGCTTATCCCGC
TGTTTCGTCGGGGCTATTGCAGCCCACTCCAGGAGAAGGACTTGTTTCCTATCGGCGACGAACTGGCCTCTTCAAAGCTT
ACTGACAACCTAGATGCTGCCTGGCAAAACACAAGCATCACTTCAAGACGTCGGCTTGCGCTTGCTCTGACAAAAGCATT
TTACAGGCAGCTGCTTTTCCTCCACCTCCCACGCCTTGCGCTGGTCGGCTTCGCCATCGCCCAGCCTGTGCTTGTGCAGT
CTGCACTTTCATACATTACCCACCACGCGACCAGGCCGACTCAGTTTGGATACGGCCTCATAGGAGCGTTCGCACTAGAT
TATATCTGCGTTGCTGTATCGACCGCCTGGTACCAGCATCAGACGTACCGCTTGCTAGCCATGATCCGAGGATCCCTGGT
TGGTATGATCTTCAAGCATAGCCTACGTCTGCCGGCATCAGAAGATGCTGATGGCTCTAGTGCTATCAGCCTCATGAGCA
CTGACGTCGAGCGTGTTGTCCAGACCTTGCAGTGGTCGCTGAACATTGTCCCTGACATTGTTCAGGTCGCACTTGGCTTG
TGGATTCTTGAGACGCATTTAGGTGGCATCTGCATCGCACCGCTGATTGTTGCTACTGGTAAGTTGTCAGACCTACGTTT
GCCTTGATCTTCTACGTTTTGTTCCGTGTTGTTATTTAACACACCTTACAATAAGTGCTGTTGTGGCCGGAAATGTAGGA
AAACGCACTCCTCCTCGGCAAAGGCGCTGGATGCAGGCCATACAGAGTCGTCTTAAGGTAACCACCAAGGCCGTTAGCGA
GATGAAAGGCATCAAGATGTGTGGCCTCACCGACATAGTGGTAAAGCAGATTCAGGGCTTACGGGTGTCCGAGATCAACG
ACCAGAAAGCGTTCCGCAAACTGCAAATCACCAACATCGCCGTCGGAAATGCGCCTGCGATGATTACTCCGGCCATTACT
TTTGCTACATTTGCCATCGAGCAGAATCTTTGTTCAGGGAACAGGTTCGACGTCGTCAGCGCTTATTCCTCACTGTCTCT
GCTTTCTATCCTTACCAATCCTATCGCTGAGCTTGTAACTGCTACCACTAGCCTGGCCTCTGCCCTAGGATGTCTTGATC
GTATCCAGGAGTTTCTCCAGAAAGAAGCACAGCAGGATGGCCGCATACTTCTGCCCGCTGCAACTGCCAACCTCGAAGAC
TCTAGTATCGCATCTACTACCCCCGGAACAGAGTTGCAGCCTGTTGGTCACCAGTCGCTTCGCTTCCAATCAAAGAGCCG
TGGACCTATCGCTATCATCCATAACGGGACGATAGGCTGGGTTCCTAGCCAACCAATTCTTCGGGCAATAAGCCTCAAGG
TTTTAGCATCGACATTTACCATTATCATTGGACCAGTTGGCTCAGGAAAATCCACATTGTTGCGGTCTCTGCTAGGAGAA
AGGTGCTTAATTTCTGGCAGCGTGGAATGTGTCTCGCCTAAGCAGACAGCCTACTGCGATCAGCAACCATGGATCCTTAA
CATCAGCCTAAAACAAAACATCCTTGGTATCTCTGACTACGACGACGATAGATACAAGATGGCCATAGAGGCCTGCCAAT
TACAGCAAGACTTTGCACAGATGCCAGCGGGTGATTCAACTCTTGCTGGCAGCAAGGGTGTGTCCCTTTCTGGGGGTCAG
AAACAGAGGATTGTAAGCAGACATAGGTCTAGTTTACCCACTTAGCTATTGCTGATCTAAATATGTCTGAAAGGCTTTAG
CCAGAGCGGTTTATAATAGAAAACAGCTTATCATCTTAGACGACAGCCTTACTGGTCTGGACTCCGATACGTCTTTGAAA
TGTTTTCAAGCACTTTTCGGAAAATCAGGGCTCTTTCGGCGCGATGGGATAACGGTTGTATTTGCAACAAACAACAGTAC
GTATATGCACAAGGCAATAACTCTAGCAGTCTTCGGTCCGAACTATACTAACATAAGATCAGTCCAATGGCTCCCATTTG
CAGACAACATTATCGTTTTGGGGCCAGAGGGCCAGATAAGCGACCAGGGTACTTTCCAATTTTTGTGCGAGTCTAGCGAA
TATTTAAAACAGCTGCAAAGTACACAGAAAGGGCGATATGACATCAAGAGCGACCATGAGATAATGCCGTTAGAACTAAC
CGACATGCCAAAGGCGGCCCTCAGGACTAGTGCTGTTGCCCTGGTGGCTTCGAAAGCATATGACAATAGCACGGATGAGA
GCAACACGCAACAGAAGGAACGGAAGAAAAAAACGGGAGCTCTCTTATATTACATTTCGTCCCTAGGCTTTGGGGCCATA
TGGGGATTCTTTGCTTTAGTGACAGCTTTAGTCGGATGCAACGCCGCACAGAGTGGGTTCCTATATTCTTCTTTTACTGG
TGGGCGTTGTGCTAATCTATCCTTGTTTCTACTAGCTCTGTGGCTCAAGTACTGGGTAGCTGCGTACAATCACCACCCGA
ACGAGAGCTTAGGGAAGTGGGCAGGAATCTACGTGTTATTCGCTGTCGGATCTATTCTTTTCATTGCTCTTGACACTGGG
TAAAGCTGAACAGTCTACCAACCATCATCAATCCTGTACTGACCTGGAAGATAGAGATTTTCTGCTATTTCTTGTCCCTC
GATCTGCTACGAACCGGCACCAAAAATTGCTCCGTGCGACTCTGGGGTACGTTGATACCATTCTTTACATAGACTTAGGC
ATTGACTGACAAAATCTCTCGCAGTTCACGGCTCTCCTTCATCACAGCTCAGGACACAGGCACTATTATCAACCAGTATG
TTTTATCTCAAACTATCGGCACCAGATGCATCTAGACCACCTTTAACTTACCATACTGACCTGAAACAGCTTTTCAGGAG
ACCTCAACCTCACCGATCTTGCCCTTCCGCTAAGCTTTATCCTTACATCTGAACGACTTCTCTCTACAGTCTCGGAGATA
GTCCTAGCATGCCTCGCATCTGGGTATCTAGCTCTAAGTATTCCAATCTTGGTGCCGACTCTCTACATCTTGCAACGCGT
CTACCTCAAAACGTCTCGCCGGCTGCGTACGCTCGAGTTAGAGTTAAAGGGCCCGCTGTTCGGCAACGTCATTAGCACGC
TCTCTGGCTTAGTTACCATTCGCGCTTTCTCGTGACCTCGACCGCGGAGAGAGAGAACATGGAGCTTCTAAACAGCGCAC
AGCGGCCCTACTACCTGCTGTTCTGTGCGCAGCGCTGGCTGACTTTGGTCCTAGATTTGGTAACGGCGGGTCTAGCCACA
CTCCTTATGGGTCTCGCTGTGGCCCTGCGGCACAGCATAGACCCTGGATTTCTCGGTGTGGCGCTGGTTAGCGTGATAAG
CTTCGGGGCGATCGCAGCCGGCCTGATCCAGAACTGGACCAGCTTGGAAATGTCCTTGGGGGCTATTACCCGTATACGAA
ACTTCATTGATGACGTACCCGCAGAGGCTCAAAGCAGGGATACGGAGGCAAAGATCCCTGCAGACTGGCCCTCGTCTGGA
GAGCTGGTGCTTCGCAACGTGTCTGCTTCGTACGATAATGGAAGCCACAAGGTCTTGAACAACATCAGTCTCGCCATTCC
GGCGGGCTCCAAGGTGGCCATTTGCGGACGAACGGGAAGTGGAAAGTCGAGTCTTCTATCACTCTTGCAGAGACTTCTAG
ATCCCGACAGTGGGAGTATTAGGATCGACGGCGTGGGCTTGTTTGATATACCCCCCAACAGAACGCGCACGTCTCTTGTC
GCGCTACCGCAGGATCCGGTCTTTCTCAGTGGTTCGATTCGACTAAACCTGGATCCGTTTGAACAGCACAATGGTGATGA
TGGGCCGCTGCTGCAAGCGCTGGAGAAGGCTGGTCTTAGCTCTTTGGTGGCCGACAAGGGCGAGCTGGACGCTGACCTCA
AGGTGGACCAGCTTAGCACTGGTCAACGGCAACTCTTTTGTGTAGCCCGAGCTATGCTGAGGAAGAGCCGGATCTTGCTC
TTGGACGAAGCCACAAGCCAGTAAGCAGTCGATCATTTTTACTCTCAAAGAATACCAAATCAGAACTACATGTTAACTGT
CATTAGCCTGGACGCGAACACAGAAAAGCTTATTACATGGCTGATTAGGACGGAGTTTCAAGACTGGACGGTGCTCGTCG
TCACCCACCTGGTTAAATCCGTGGCCGAGGCCGACTCCGGCTTCGACGAGGTGATTATCCTGGAGAATGGGAGAATTGTC
GAGCAGGGCAACCCAGCGGTCTTGCAAGAAAGAATGGCGTCTTTCGGGAGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62