GenePrediction:GLEAN_2070 Details

Name: GLEAN_2070
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:524820..529856 (+ strand)
Length: 5037
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:524820..525009 (+ strand)
Length: 190
Type: CDS
Source: GLEAN
Position: GCSC_108:525077..525441 (+ strand)
Length: 365
Type: CDS
Source: GLEAN
Position: GCSC_108:525928..525967 (+ strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_108:526044..526516 (+ strand)
Length: 473
Type: CDS
Source: GLEAN
Position: GCSC_108:526602..528478 (+ strand)
Length: 1877
Type: CDS
Source: GLEAN
Position: GCSC_108:528635..529856 (+ strand)
Length: 1222
>GLEAN_2070 class=GenePrediction position=GCSC_108:524820..529856 (+ strand)
ATGTCTCTGATCGTACCCAAGGCAGCGCCGGCCATCAGCGGCCTCTTACCGCGAGACACTGTCAATCCGTCCTGCGTGAG
CTCGTGCTCCAGCGGCGCCATCACCACGTCCGATCTGTGCAGTCTGGGCATCGCCGACACAGCCTTTGGCGCCTGCGTGA
AGGATGCCTGTGCTTCAGAGGACATTACAGGTATGCTCTGTCTTTGGATCTGTCGTTGTTATAGTATTGCATCGACCTGC
TGACACGGCCCACACAGCATTTTTAGCTACGGTGACGGCATCCTGTGTCAGCGGTGCCTCCTGGGCGTCGTCGGGCTGGT
CGTCCGCCACCATCGCAGCGACAGCGTCCGTCACGTCAGCCCCCGGGGCCTTTCCTAACTCGACGCTGACGGTGCTCCCA
TCCGGTCCGGCTAGCTCGGCAGCGGCTAGCAGCAACGCGACGACGGCCAGCGCCAGCCTCAGCAGCCTCAGCAGCCTCAG
CAGCGCGAGAGTGGGCGCGTCTTCGGCTGTGTCGGCGTCGACTACTCCGAGCTCGAGCCGGCCAACAGACGCGTCGGCAA
CGACGTCAGCAGCATCGAGCACGGCAACCAAGAAATCGGCCGGCACGCGGGCCTGGCCAGGCGTCAGATGTCTGGTCCTG
GGGCTGGTTGTCGGGGCAGTGGGCACATGGATCCTCTGAGAATGGCGCGCGTCAAAGGACGGTTTTGTGGGAAATCTAGC
ATACGGAGTACTACGTCGTATGTGATGGCAGGTGGAGACATGGAGACAGAAAGAGAAAACATGGCTGATCAGCAGCATTG
ATGCGCAGACAGAAGTGCGCCGACTCGCTTTCGATTGCTATTTTTACTCTTCTTGAATAATTCATACACACTACCAAAAC
TACCCCCAAAAGGCAAAAGCTTATTTAGCACGTTTATCCCGTTCGAACAAGTGTTTCCATGGTTTCCACGGAAAACTGGG
GCGGCCAGAGGCGCACGACGTAGCAGGCCGATGGATTTTTGTAGATTACCTAAGGCAGAGTTAAGCCACATAGGGTCAAC
GTGGTCCCACTTTCAGGGGCTGAGGCGGGATGCATATCGTTTCTCAAACCCTCTTCCCTCCTGCGAAGCCGCTTTTCTTT
CTGGCCAACCCCGGCAAGCTCCGCATCTGTACGTATGCTTGAACGAACGAGTTTAGCCCAATACACCTTTCCGACTCGGG
CATACACACCTGCGCATATTCCAGCCCACCTGCTTATCGTCCAGAGCCTTTTCCCGAGCAGACCTGCCTCAGCTACTGAT
CATCTTTGCCTTGCCGCGATTGCCGACGCTTTTTCTGTTGCCCATCCTTTGTCTGCCCTCGACCGTTTGGCTTGTCCGCG
CGACGTCTACGACCGTTCCGCTTTCTGCCTGATTTTCGCCGGCCGGTCGAGCCCGCCGCCGGTCTCTCCTCGCTCGGCGT
CGCGTCGCCTGCGCTCGCGCGCTCCCAACCTTTTCCAGCCATCGACGACACAGGCTCCGGGTCCGATGCAACGGCAGCAG
ATGCACCGCCGCTCGCCCGGCACGGAGCCTGGCCCGGGAGGCCCGATGCAGAGCATACCCGGACGGAGCATGCCGCAGGC
TGTCGGGGTCGGCATCGCCGGACCAGTGTCGTCTCGACCATCCAACGCCTCCATTCGATCGACAGGCGGCAACAGCATCA
ACGGGAGACGGGCTAATGTAAGTTTTCCTTCTCTCTGTCGCGTCGGTTGGGAACGACGTTTGGGTGGCGCATCGTTTTTC
GTTGTTAACGGTTCCCCGAAAGAATGCAAGCACCTCCGGCTCCATCTCCGGCTCCATCTCCGGCTCGAGCTCCAGCGTGC
CTCTCTCACAGATCGAAAAGAGCGTGACCCATCTTCTCGTTGCAACGAAACAGCTGCTGGAAACACTGACACAATGGTCG
CGCGGACAGGCGACGGACACGCAGGTGTCAGATGTCTACGTCCGGTTGGGCTACGAATTCAACATGGCCTGCCGCGCCTT
CACGGCTATTAATGTGGACACGTCGGATCTTGGGAACGTGCCGGAGCTGTTGCGCAATATCCTGGAGGCCACACTGAGCC
AAGAGGCCAGCAGCGAAAGCCTCGACAAATACCTCCCTCGCATACGCGACATTATCATCAATCTCCTGCACGGCCTCAAG
CGGAAACAACAGAAGCTGCGGCAAAAGCAGGCGCGCGAACGAGATTCTGGGGTTCCAGGCGGCGGCAGCGGCGGCGATCC
CACACGAACAGTCAGCGTCAGCACGATTGCCAGCTCTAGTTCAGGACTGTCAACCATGTTGAACGAAGGCATCGACAACG
GCTATCGTGGCGACGGGCCACAGCCTCCGCCACAACCACCGGCTCCACCAAATCGTGATGGCGTCAATGGCCGGGGAGCG
TCTCCCGGCCGGCGATACGTTCCTCCGCGAGACTCATCGCAGGCGTCCATGAGCCCCGAGCAGCCCAGCCTGCCGAGCAC
GCCCAAGCAAAACGGCCCGACATATGTCAGCACGATAGAGAACCCGTCGGGGCCGAATACGCCGGCCGGCGAGCTGAACA
TTGATGCCTTCCCTCCACCACCACCGCCCAAGTCGCAGCAGAGCGCGCTGATGGCGCTGCAGCGCAACGGCGACCATCTG
GAGCGACGAGCGTCACGGCGGTACTCTCAGTACCACATCCAGAAGCACCTCGGCAGCAGCTTTTCGACGGGCGTGCCGCT
GCTGCCGTCGCAGAATTCGCCGATTCCCAACCGTGGCCGCGCCGATGTGCGCGAGTCGATGCGGGCAGTGCAGGTGCGGG
AGGGCGCGACGCGGTCGAGTCGCAGCGGGTCGTCGCTGTCGCGAAACGGCTTCGACCTGTCTGCAGCACAGGCGGCGAGC
CAGATCGCGGAAGAGCAGAGTGGCAGCGAGAAGGAGGTGGTGGTGGCGGCCGGCGAGACGGGGCGTCGTGGCGACAGTCC
GATGGCAAAAACGCCCGACGACTTGTACCCAGAAACAAGTGCAACGCTCAACGGCCCACCGACAGACCTGATGCCAGCAA
TTTCGGCGGAGGACGAGGACAACTACCGGTCGTCGGTGCCACGACGCGGACGTGCCAATTCGAGATACGGCGGCGGCGCC
GTGGCCGAGATGCCGGCGTCGACACCAACGGAAGCATCGACAAAAGCGGCCATGTCAGCAGCAGCATCGACAGTGTCAGC
TTCGCCAGGCGCCATGGTGCAGTCACCACCGACACCGCCGCCACAGCCGGGCGAGCCGGCGTCCAAGGAGCTGACGCTGT
TTTTACAGTACAAGTCCAAGGTCAAGAAGTTCATGCTGCCAGAGGGCTACAACGAGCTCACGATCGGGCGACTGCAGCTG
GCTTTTATCGAGAAATTCTCGTGGAACACACAGCAGAACGGGGCAGATCTGCCGGAGATCTACATCCAGGACCCGGTGTC
AGGGGTGCGGCACGAGCTGGAGGACCTGGCGGACATCAAGGACCGGACAGTGCTGGTGCTGAACGTGGAGGCGCTGGACG
AGGTCAAACGGCACATTGACGAGGGTCTGGGGTCGCTGAAGCAGATGGTGCAGCAGGTGAAGCAGAACGTGGACGAGCAG
GGCGCGGCACTGCAGCGAGTGTCGGACCGGCAGCAAGAGGCGGCCAAGGAGATGACACGGTTAGCAACAGCAGGGCCGAC
GCATCCGATGACACCGCCGGCGGGCTCACCTCGGGGGGGCAGCAGCAGCGGGGTGGCGACATCAGGACGGGGCAGCAGCA
ACAGCTTCAGCGGCAGCAGCCGATTTTCATCACAGCAGCTGGGCGAAGTGCGCAGTCTGCGACGAGACCTAGCAGTGTTG
CGACAAATGTACTCGAGCTTCCAGTCGGACATGGAGAGCTCGATGACGGCAGTGCGCAACAAGGCAGCCAATGTGGCCCT
GGCAGCGGCCAAGGCAGTGATTCCGGATGTGGAGGACGGGGGCGGACAGGCGCTGGTGGCACAGGGCCGCAAGACGCTCA
ATGCAGAGTCGGACCGGCTGGTGACCAAGGTGGACGACCTGCAGGACCTTGTGGAGGACCTGCGCAAGGACGTGGTGCAC
CGGGGTGTGCGGCCGCTGCCACGACAGCTGGAATCGGTGACGAAGGACATTACGCAGCTGGCCAAGGACCTGAGCAAGAT
GGAGGAGACGATGCGGCGGGAGAAGCCGCTATGGACAAAGATCTGGGAGAAGGAGCTGGAGGAGGTGTGCAAGGGGCGGG
ACGAGCTGCAGCTGGCAGAGGATCTGCTGGTGGACCTGCGAGACGACCTGGAGAAGGCGTCAGAGACGTTTGCGCTGGTG
GAGCAGGCGACCAAGGAGCAGATGAAGGACACGGGTGCGGGCGGCAGTGCTGGCGGTGCAGGCAGCGAGAACGTCCTGGG
CGGGGTGTCGCTGGTGGCGCGAGGGCTGCGGAGCATCGGGGACAATGCCGGAGTCGATCCGAACGCGGCCAAGGAGGGCG
TGCTGGGGGAGGTGCGGGCGCTGCAGCCGAACCACGAGAACCGGCTGGAGGCGATTGAGCGGGCGGAGAAGCTGCGGCAG
AAGGAGCTGGAGAGCCGGCGGGTGAACCCGCTGATGAAGGAGCTGTCGGACTTTGTCGACGAGGGCCGGCTGAAGAAGTC
GGGTGGATACGAGGAGGTGGAGCGAGCGCGACGGGCCAAGGATGAGCAGATCCGGCGACAGGTGTGGGAGCGGCAGAACG
GCATGATCTTTGACGAGGCCGACATGGACGGACTTGAGGGCGAGGAGGGCGAGGAGGGCGAGTACCTGGAGGGGGACGAA
ATCGACGACCTGGACGGGCTCGAGGGCGACGAGGAGGACGGAGACGTTGAGGGGGTCGAGGATGAGGGCGAGGGCGAGGG
CGAGGGCGAGACGTCGCTCGAGGGCGAGACGTCGCTTGAGGGGGTGGACGAAGATGGGGAGGTCGATCTGGACGCGTTGG
AGGGCGTCGAGGCCGAAGGAGTCGAGGCTGAAGGGGACGAGTCCGTGGTGGCCGACAGTCCGGTATCGGTCCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62