GenePrediction:GLEAN_2071 Details

Name: GLEAN_2071
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:535092..536841 (+ strand)
Length: 1750
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:535092..535199 (+ strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_108:535267..535405 (+ strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_108:535466..535750 (+ strand)
Length: 285
Type: CDS
Source: GLEAN
Position: GCSC_108:535807..535874 (+ strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_108:535937..536319 (+ strand)
Length: 383
Type: CDS
Source: GLEAN
Position: GCSC_108:536377..536444 (+ strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_108:536501..536841 (+ strand)
Length: 341
>GLEAN_2071 class=GenePrediction position=GCSC_108:535092..536841 (+ strand)
ATGAGGACCTTTGCTCTCGCTGCTTCGCTTCTGGCCCTCCTTTCCGTCCGGCAAGCAGCCGCTATCTCGCTGCTCTCTGA
CCCGAACCCGTCGCCTCCAGCGTGCGGTGTAAGCCGTCTCGTCTCTTTTCCGTTTGCGGCTGTGGCCAACGTGCTGATGC
TGACACTCGGAGCAGCTGTCTTGCACGATGCACTACGTGCTCGAATCCTCCTCCTGTTCCCTCACAAACATCAGCTGCAT
CTGCGACGACGGGCCACTCAACGACCTGGTCACGCTCTGCGTGACGCAGAACTGCACTGTTCACGAGCAGCTTCGTAAGC
ATTTGGAATGCCTCTTTCTGTCCTCTGCCACGGCAAGCAGCTGACCCTGGCCAGAGATGAAAAACTACTCGATGACCAGC
TGCGGCTATCAGACACGAGACCGCTCCACGCTCATCTGGCTCATACCCGCCATCTTCGGTCCGGCGGCCGTCATCGCGTT
TGGCTGCCGCATCATGGCCCGGGTCCTCGTCAGCTTTGAGACCTGGGGATGGGACGATACGATCATGGTCGTCACAATGG
TGCGCGTCCACACTGCCCGTTCACACGTCTGCTTCGTCGCTGCTGACACGCGAGCCTGCCAGTTCCTTGTGATCCCGCTG
CAGATCTTCAGTGGTCCCCGTGAGTCTGGGCGACATATCCCGTCTCCTGGTGCACATTGCTGACACGGAGCCCAGTTTCC
CAGCTCGGCCTCGGGCGCGACATCTGGACCATCACGCCGAAAAACATCACCGGCATTCTCTATGTGCGTATGCCCAGCAC
ACCCGTCAAGCTATGCCTGTACAGAGCGCCATACTGACAGGCCAGTTGTACTATTGGGACGAGCTCCTCTACCTGGCCGC
TCTTCCCATGACAAAGATCTCCATCCTCTTATTCTACCGCCGGATCTTTCCCAGCCCGTTCTTCCGCCGCGCCGTCTGGC
TTCTCATCGGCTGCAACGTCGGCTACCTGATCGCGTTCAACATCGTCTCGGTCTACCAGTGCAGCCCGCTGGAAGGTGCC
TGGAAGGCCTGGGACGGCACCGTCCAGGCGCACTGCCGCGACATCAACGCCCAGAGCTGGGCTGCTGCCATCATCAACAT
CGCCCTCGACCTGGCCACCATCATCCTGCCGCTGCCGGAGCTGTCCAAGATACGGCTCTCGATCGCGAAGAAGTTCCAGG
TGCTGCTCATGTTTAGCCTCGGCTTTTTGTGCGTACGAGGCCTTGCTGATGCGTCCCCCGATCTCCCAGTTGGCTGACTA
AGCAGTGTCACGATTGTCAGCGCCATCCGGCTCTCGTCGCTCCAACAGTACGGGACGACCACCAACTTCACCCGTAAGAC
AGACCAGAATCCGCTTCTGCTGTTAGCACAGACAAAACTGACCATGCAGAGGACTATACGGAAATCGGGTACTGGAGCAC
AATCGAGGTGGCAGTCGGCGTGGTATGCGCATGTCTCCCGGCTGTCCGGGCTCTCTTTGGACACATCCTCCCCGGCGTCT
TTGGCACCACCGTCAGAGACAAATCAGAGTATATACAGCAGCGAGACGTGTTCTCGACACAGCGCTCCCGTCAGGCAGAC
ATAGTGGTCAAACAGCAGTGGACTGTTTCGTCTAGAAGCCGGGAAGAGTCATCAGTTATCGAGCTCGATGTGATGCCATC
GCTGGACGATCAGGGCGAGGACAGTCACGTAGGAGAGAAGAAGGCCACAATACCACGTGAATCGGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62