GenePrediction:GLEAN_2072 Details

Name: GLEAN_2072
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:537681..539154 (+ strand)
Length: 1474
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:537681..538527 (+ strand)
Length: 847
Type: CDS
Source: GLEAN
Position: GCSC_108:538590..538764 (+ strand)
Length: 175
Type: CDS
Source: GLEAN
Position: GCSC_108:538824..539154 (+ strand)
Length: 331
>GLEAN_2072 class=GenePrediction position=GCSC_108:537681..539154 (+ strand)
ATGCATCTGTCTGCCGCTCTGCTCGGCCTGCTCTACGCAGGCAGTCCTGCCGTCCAGGCCTTTCCCGATCTCTTCTCAGG
ACGTTCCTCGGACCGTAGTCAAGGCCCGGCTCTAGATGATGCATCACCGCTGCCGTGCAAATGGTCCATCACGGCCACTG
CTGCCGTCCGCCGGACCAAGAAGAAGCGGCTCCTGTTCGACCCGCTGACGACGCCGATCGAGGTCACTGGCGAGCACGTT
TTCATCGCGCCCGACTTTGCTGCCGGCGACCAGCGGGGGCCCTGTCCCGGGCTCAACGCGTTGGCGAACCACGGTTACAT
TGGCCGCAACGGCGTCACCAGCCTGCTCGAGGCCACCGCGGCCATCAACGAAGTCTGGGGCATGGGCATCGATCTCGGCG
GCGTGCTCGCCCTTCTGGGCACCGTCTTCGTAGGCAACCCGCTCTCGCTCGACCCCGGCTTCTCAATCGGCAACACCTCT
TCGGCCGTGCACAACCTGCTCGGCGATCTCGACGGCCTCCTCGGCACGCCGCGCGGCCTCGACGGGTCCCATAACATCAT
TGAGGGCGACTCATCCGCCACGCGCGCGGATCTCTACGTCACTGGTGACGCCTCCACCCTCGTGCTCCAGCAGTTCCGCG
GTCTCTACGACCGCTCTACCGGCGAGGGCGACTACAACATGGACGTCCTCGGCGCCCATGCTGACGCCCGTTTCACCGAG
ACCGTCGCGTCCAACCCGCAGTTCTACTACGGACCCTTCACTGGCATGATCGCCCGCAACGCCGGCTACATCTTCTCTGC
CCGCATGTTTGCCAATCACTCCGCCGCTAACCCGACAGGACTGCTGAGTAAGCAGACCGTCCGATCCTTCTCACCCGGCA
GGACGTCTTTGCTAACGCCTGTCGAGCAGACAAGAAGACGCTTATGAGCATCTACGGTGTCGAGATGATCAATGGCACGA
TGGTGTACAATAAGGGTCACGAGCGCATCCCAGAGAACTGGTATCGCAGGCCAGTCGACTACGGTTTGGTAGAGCTCAAC
CTCGACATTGTCGCTCTGATACTCAAGTACCCGCAACTTGCTAGGTAAGTCGAGCGTCCCTTTGGTTTTTGATTTTCTGG
AAGCCCAGGCTAATGCGCACAAGTATCGGAGGCAACGTAGGCACGGTCAATAGCTTTGCCGGCGTAGATCTCGGCGATCT
GACCGGAGGTGTGTTGAACGCCGCCAAGCTCCTCGAGGGAAACAATCTTCTCTGCTTCGTTTTCGAGGTGGTCAAGACGC
TGGCGCCAAACTCTCTTTCCTCCCTGTTTGCCACCATCGAGGCACCTCTGCAGCTTTTGCTGGACACCCTCGACACAGCT
TTGCTTAACATTTCGTGTCCAGCATTCAAGGACCTGACCATAGGGGGTACACCCTTTCAGGATGCTCTTACCAACTTGTA
CCCAGGGACGAACGTTACTGGCTCTGTGTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62