GenePrediction:GLEAN_2073 Details

Name: GLEAN_2073
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:542010..542821 (+ strand)
Length: 812
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:542010..542592 (+ strand)
Length: 583
Type: CDS
Source: GLEAN
Position: GCSC_108:542778..542821 (+ strand)
Length: 44
>GLEAN_2073 class=GenePrediction position=GCSC_108:542010..542821 (+ strand)
ATGTCGGTTACGTTAGGCGAGCAGCGTTCCTTTTGCGAGAGAACTATGTCTCAACAGCACACGTTCTTCCCTCCCAAGGA
ACATGATATCTTTAGCAAGCTGACCGATCAAATCATCTCCTCCGATGCTGCTCTCATGCTCTCCGATGAGCTTTCCTGTG
CTGTACTTGACAAGTTACATCCGCACCTTGATCTCTTCGCGAAAAAGTCCAGCTCGCATATCGATCCTCTCCACGTCCAC
CTTTATAAAGGACGAGCCGTGACCATTGTCGAACAGGCCCGGCTCCATCTCGTTTGGCGCTCGGACACAATCTACCTTAA
ACCGCTCCCGACATGCCTGCTAAGCTCGGATTTTTGGCGTGACCACCTTACGCCGGAAAATCCCACCCGGCCTCAGGCGC
TGGGCTTCATGCGGACATACGCCCACCTGATCCGCCACCGATCTGACTTTCTCATCGCGCAGAAGGAAAATCTGATCCCG
CCGTCCGAAAATCTTACGTACGGAGAGTTTAAGGCTTTCATCCGATATTTTCGTAGCGTCTCAGATGACCAGGTGTCGCT
GCGGTGGAAGTTTGGTCAGATCCGTCTAAATTGGCTAGACTGGGCCGTCAGAATCTTCCAGCCAGAAGTCCCTGGGCAAC
AAGGGGGCATATTACGAAGATTGTTCTACGAGGAGCCTTACCAACAGACGAGGCAGTATATCCGCGAATTCGGGGCTCCG
TTTATTTTCATTTTTGCAGCACTGTCGTTGATCTTATCGGCAATGCAGATTATCCTAGCGGCGCGGCCCGACAACCCATG
GCCGACGTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62