GenePrediction:GLEAN_2074 Details

Name: GLEAN_2074
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:552906..554164 (+ strand)
Length: 1259
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:552906..553172 (+ strand)
Length: 267
Type: CDS
Source: GLEAN
Position: GCSC_108:553255..554037 (+ strand)
Length: 783
Type: CDS
Source: GLEAN
Position: GCSC_108:554099..554164 (+ strand)
Length: 66
>GLEAN_2074 class=GenePrediction position=GCSC_108:552906..554164 (+ strand)
ATGGCGTCTGTTAGTGGACCGGAGGCGACGGCGGCAGCCAACAGCCATGCCGCGAAGAATGCCAAGGAGCTGCCACCGGC
TCAGGCCACAGAAGCCGTGCTCGTAGTGTCGGAGGAGATGCCGGCCAACGCCCAAAAGGTCGAGGAGCTGGACTTCAACA
AGCTCAAGGGCCGTCCCATCACGGTCGACGATCTGTACCAGGGAATGAAGAACATGGGCTTCCAGGCGTCGACCATCGGC
GAGGCTATCCGCATTATCAATGATATGGTGATTTTTACCTCTCTTTTTCTCTGCAATTTTCCTGATTCAGGATCCTTTGC
ACACAACTGACACATGACCCCCTATCAAGAGAGCGTGGCGGGACCCCGAAACAGGCGACGGCACCACCATCTTCCTCGGC
TACACGTCCAACCTGATCTCGTCCGGCCTGCGGGGTGTCTTGCGCTACCTTGTCGAGCACAAGCACGTGTCCTGCGTCGT
GACGACGGCCGGCGGGATCGAGGAGGATTTTATCAAGTGCCTGGGCGACACGTACATGGGCAGCTTCAGCGCAGATGGCG
CGGACTTGCGACGCCGCGGCCTCAACCGCATCGGCAACCTGGTGGTGCCCAACGCCAACTACCGCGCGTTTGAGGACTGG
ATCGTGCCGATCCTCGACACGATGCTGGAGGAGCAGGAGGCGGCGCGGGCAGCCGGCGACACGGAGTTCCACTGGACGCC
GTCCAAGGTGATCCACCGGCTCGGCCGCGAGATCAATGACGAGCGCTCGGTGTACTACTGGGCCTACAAGAACGACATTC
CCGTCTTCTGCCCGGCCCTGACGGACGGCAGCCTCGGCGACATGCTGTACTTCCACACGTTCAAGTCGTCGCCGCAGCAG
CTGCGCATCGACCTCGTCGAGGACATCCGCCGCATCAACACGCTCTCGGTGCGGGCCAAGCGTGCCGGCATGATCATCCT
CGGCGGCGGCGTCGTCAAGCACCACATCGCCAACGCCTGCCTGATGCGAAACGGCGCCGAGTCCGCCGTGTACATCAACA
CGGCGCAGGAGTTTGACGGCAGCGACGCTGGCGCTCGTCCGGACGAAGCCGTGTCGTGGGGAAAGATCAAGATTGGCGCA
GACGCTGTCAAGGTAGGACACGCTTCCGTGTGTTGTCCTGTGCTGGCTGACAATGCTGACAACCGCCGGTCAGGTTTACA
TGGAGGCCACGGCATGTTTCCCCCTTATTGTAGCAAACACGTTTGCAAAGGAGCCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62